Gene MALT1 Variant 2
DNA : 78.75 KbNT_025028
mRNA : 4996 bp NM_173844
CDS : 2442 bp NP_776216
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  467 bp
attcctccaccgcttcctcctccagctgcacccacccgtcctttcctgctcgggagggct
gggtttgaagcgcgcgccacggccagcccgggaccgcgggggagggcgagggaggcgcgc
agccgcacgcacgcagtaggcagccccgccccgcccctcgaggcccaaggtcccgcccct
CGAGGCTCCGTGCCCCGCCCCCCGGGTGCCCCGCCCCTTTGCGCGGCTGGCGCGGCCAGC
AGGCCAGGCTCCCCTCGGCAAACCTGTCTAATTGGGGCGGGGAGCGGAGCTTCCTCCTCT
GAGGGCCGTGCCGCGCTGCCAGATTTGTTCTTCCGCCCCTGCCTCCGCGGCTCGGAGGCG
AGCGGAAGGTGCCCCGGGGCCGAGGCCCGTGACGGGGCGGGCGGGAGCCCCGGCAGTCCG
GGGTCGCCGGCGAGGGCCATGTCGCTGTTGGGGGACCCGCTACAGGCCCTGCCGCCCTCG
GCCGCCCCCACGGGGCCGCTGCTCGCCCCTCCGGCCGGCGCGACCCTCAACCGCCTGCGG
GAGCCGCTGCTGCGGAGGCTCAGCGAGCTCCTGGATCAGGCGCCCGAGGGCCGGGGCTGG
AGGAGACTGGCGGAGCTGGCGGGGAGTCGCGGGCGCCTCCGCCTCAG
gtgagctcagggccgcggcaggccgggcgcgcgggtcgagcggggtgggctgcggtgggg
aggtgggggcgctgtcggtggggctgagcgcggcgggggccgccggcgtgagtgagcgga
ggtggggaggacttcggtcattgaggcggagcggaactcagcagctccccggaacgcctg
EXON 2  167 bp
gaggaattccccgtgatgaaagaggaggaaaggatactcgcattcattatgtgaatagtt
tgtcaccacccacccactcacttgtgatttattccatacagcaccaccgtggtccagata
tatagcaggtgtatcatgtggaagaaagctgttgacttgaattctttctgttgctttcag
TTGCCTAGACCTGGAGCAGTGTTCTCTTAAGGTACTGGAGCCTGAAGGAAGCCCCAGCCT
GTGTCTGCTGAAGTTAATGGGTGAAAAAGGTTGCACAGTCACAGAATTGAGTGATTTCCT
GCAGGCTATGGAACACACTGAAGTTCTTCAGCTTCTCAGCCCCCCAG
gtaggttttgttcttaggattattctccaggagttcatggagccaaacttagaagaaatt
atctcttttgaccaggtgaactgtgttaagtatttttggaaaatgtaaatgtgtagtgcc
ttgtttgctttcccaggttgaagcaaatgcaatgcatgaatattggttggattgtggttg
EXON 3  122 bp
tacaaaagctgcaactcacaaagtgtaaattgattgagaaggagatgtgaatgagtgatt
tatgacaaagataaatatgcaagttatttctaaaatgtttcaatttttggtttcagatgt
ataaacaaggaaaatccctcttgtgactttaattttttttttttttttttttttttttag
GAATAAAGATTACTGTAAACCCAGAGTCAAAGGCAGTCTTGGCTGGACAGTTTGTGAAAC
TGTGTTGCCGGGCAACTGGACATCCTTTTGTTCAATATCAGTGGTTCAAAATGAATAAAG
AG
gtaattttttaaatatatcttttaattcttccaaggagagagaatgatagagaattaatt
aacattatcgtcctaaatgtagttttaacagtttggtaaaagagtctgatagacattgct
aggttattactgaagtagtcaatagtcattattttggtaagacagttccagaattgtctc
EXON 4  155 bp
taatacttcagtcctaaataactcaaagcgttactgtttttaactcagaaatgttttaga
acttgggggaaaaatgttgcactttcaaagcttcatactgaaatcatagattttgtacag
catattttataaggtgtgtttttgatgagtcatccacttctcttattgattctttcacag
ATTCCAAATGGAAATACATCAGAGCTTATTTTTAATGCAGTGCATGTAAAAGATGCAGGC
TTTTATGTCTGTCGAGTTAATAACAATTTCACCTTTGAATTCAGCCAGTGGTCACAGCTG
GATGTTTGCGACATCCCAGAGAGCTTCCAGAGTAA
gtaacgaaagaagctgaatgttgggatggggattccccatattttattttattttaaatg
tttacttttaaacaatttcaaagtatcaaaaaacatagcaaaatttcacataggtacttc
atccattataatgtcaaccattgttaagatttgatccatgtgttttgtctttcttttttt
EXON 5  175 bp
ttggccacagaatatctcgtaatatttctatgagtgctatagtttttttaaacagtttgg
gaaatgttattaaaaattgtaacaaatgaagggggaacttgacacatctctttaattata
gggaaattttatttttatttttaacctagagattttattttttcttttaatttaaggaag
TGTTGATGGCGTCTCTGAATCCAAGTTGCAAATCTGTGTTGAACCAACTTCCCAAAAGCT
GATGCCAGGCAGCACATTGGTTTTACAGTGTGTTGCTGTTGGAAGCCCTATTCCTCACTA
CCAGTGGTTCAAAAATGAATTACCATTAACACATGAGACCAAAAAGCTATACATG
gtaggaagttgattttggggtcttttgggggagttaacatgtaaaacaaatggtacaatt
gaaatataaggtgaacattaaaactcatatcctttcagatgttttaatgttttcagtatt
tttatttaaagtcccttatgatttcatattaactagctcttatatttgctaaagtgctag
EXON 6  97 bp
tggaatcattacaacatttacttgctggtatttaacctgatgaatggagctaatgtaaca
aatgtctaaagccttctaagatgttatgttttggagcgtatttttaaaacacaaaatgat
tttttctccaagccattaaaatagaagaggaagcatttacatgttctaatattgatatag
GTGCCTTATGTGGATTTGGAACACCAAGGAACCTACTGGTGTCATGTATATAATGATCGA
GACAGTCAAGATAGCAAGAAGGTAGAAATCATCATAG
gtaagaagtatttccccagtgttctgacaagtggactataatataagctatataaactgc
aacgtttaattaagcaaaggaaattatactttttaccccatactatttaatgatgtgtta
agcattagaagttatattgtttatattgaaatttgaaagaatgcatactaaaatcataat
EXON 7  27 bp
aatattcactattctttgctattcagtatttgcatggcttcttcatttaatttgaaaagt
tgtaaactgataaaacactataacatgattcactggctcaaaactacttggattagtctt
actatttgtgctaaattggtgtttagattacttaatctattttctcttactttgttttag
ATGAATTAAATAATCTTGGTCATCCTG
gtgagtaatacaaacataaaactttagttttagatttttaagttgttgaatgcagcaaag
ttaccgtaggtactcttttgctacagtaatactagtaacttttttctctttattgaaata
atataatttaaggttgaaattaactacatgaagtacaattttatacaagtgatacattaa
EXON 8  33 bp
acttcctattgtgaacaccaccatcgtttttttccattcaagagtgtttttattaaaaat
ctgaagagtagaaactatattctgtaagtgatgctgctgatgttatatacttttcatgta
tctttaactctggaaatataccatggatcttacatgttttgcttttttatctttgtatag
ATAATAAAGAGCAAACAACTGACCAGCCTTTGG
gtgagtagaactttaaaatgcattatcaaagtataattattgtgtataactccagaagga
atttaagacattttaatttggttttttaaagaaatgtgaataacattgggaccaaatgtt
ttatttttttgtatctgtaaaagaaggtttagaagaggaggcttaaaaatgattacaaat
EXON 9  204 bp
tcctcagagaatattgatctgcttacataaatagttctaaaatgaaattaaataatgaaa
tcttatttgaaatgaaataatgcaatcttaaagcatactttttattataataccatctcc
ataggttttgttttaatctttatatcttctttaaacaccccctttctttttttttcaaag
CGAAGGACAAGGTTGCCCTTTTGATAGGAAATATGAATTACCGGGAGCACCCCAAGCTCA
AAGCTCCTTTGGTGGATGTGTACGAATTGACTAACTTACTGAGACAGCTGGACTTCAAAG
TGGTTTCACTGTTGGATCTTACTGAATATGAGATGCGTAATGCTGTGGATGAGTTTTTAC
TCCTTTTAGACAAGGGAGTATATG
gtaagatatttataatgtttgtttttacaattatccattattcttttcattatacaagtt
aggttaagaattgaaaatcagataaagataaggtaaacatgttgttgaatggaagagttt
tatttttcttattaagatgatacatttgatcttcattccatctgaataactaattagctt
EXON 10  178 bp
caataattttaaatgcaaaataacattgtctatatttataattgggtatttcttacatat
gctcacatcaacctgaagaaaattaaagtcaaggtttttctacaaaaagttatgcagtct
gtatgttcagagtgcatttagaattgacatctatctctctcttatttttcctcttttcag
GGTTATTATATTATGCAGGACATGGTTATGAAAATTTTGGGAACAGCTTCATGGTCCCCG
TTGATGCTCCAAATCCATATAGGTCTGAAAATTGTCTGTGTGTACAAAATATACTGAAAT
TGATGCAAGAAAAAGAAACTGGACTTAATGTGTTCTTATTGGATATGTGTAGGAAAAG
gtaagttttctaatctttattaaagaattgttggagttaaatatcgaccatgacaaacta
gagaaacctgtgaaatgctaaaagccatttgcgtttgtgaattttagtttatacattgaa
actggaagaacaaaactagaggaaaatacatttactccatgtatatctaattattttaac
EXON 11  75 bp
caaggagttagtgggttattttgggtagatatgtagctacctagatgaaaaattttgaat
ctataattttaaattatgtattctaaaaaactgttgtattttctcattatttataccctt
ttaagaatgctctttaacttttcatatttctatctgccctcctccgcctcccttaaatag
AAATGACTACGATGATACCATTCCAATCTTGGATGCACTAAAAGTCACCGCCAATATTGT
GTTTGGATATGCCAC
gtaagaacatttgatgtttacgttgaagtttcctttattgtttgatgtctttttgttttt
gctttttaggagcaggggtcttaactctgtcacccaggctggagtgcagaggcgccatca
tagctcactgctcctgggctcaagcgatcctcctgcctcagccttctgagtcgctgggat
EXON 12  128 bp
tgaaacattgtaccctgtgactaacagtccccacgctgtccccacccccccccagcctct
ggtaaccaccattctgctgggtgcttctctgagttcatttttattagcatccacatataa
gtgagaacatacagtatttgcctttctgtgcctggcttaacttctttttctatttttaag
GTGTCAAGGAGCAGAAGCTTTTGAAATCCAGCATTCTGGATTGGCAAATGGAATCTTTAT
GAAATTTTTAAAAGACAGATTATTAGAAGATAAGAAAATCACTGTGTTACTGGATGAAGT
TGCAGAAG
gtaaaataaaaaataaagagaaaagtactcagaaaaaggagagcaggggagacacaccta
ttcagggttccctctctggtgattgttttattcttattatgtgggtttggaattagtacc
tactttataaaacaatttttatattaatataacgttcagcaacacttctgctatttaatg
EXON 13  150 bp
gagtaaaaattaaaacatgcctgatatgtctggcacataataggtgctcaggaaatattt
gttgagtgaataaatgatactgagaatataacctgataatgtaggatagttcttagccta
aatatttaaaacataagaattggtggtcttaaaaataatatttattttcatatcttttag
ATATGGGTAAGTGTCACCTTACCAAAGGCAAACAGGCTCTAGAGATTCGAAGTAGTTTAT
CTGAGAAGAGAGCACTTACTGATCCAATACAGGGAACAGAATATTCTGCTGAATCTCTTG
TGCGGAATCTACAGTGGGCCAAGGCTCATG
gtacggtaaagcccattttttgttagatctacaatatacttaacgttaaatcataaagtt
tcttctgaataaataactttcctcccagttttacagtgaaaatattttggcctactaggc
aaatctcaaaccaaacaaatatttcaattatggatattacactggcttatttgatttaga
EXON 14  158 bp
gtaaatgaaagactttgtttggccagcagaatagtgagcattattttttaaattgtatgt
gtttaaacaatgtaaatcatgtttttaagcaaaagaaatgctaactatattctcctccat
aaatatttgcctcttatcatcagaaaacctaccaaagttgttcttattgttctttttcag
AACTTCCAGAAAGTATGTGTCTTAAGTTTGACTGTGGTGTTCAGATTCAATTAGGATTTG
CAGCTGAGTTTTCCAATGTCATGATCATCTATACAAGTATAGTTTACAAACCACCGGAGA
TAATAATGTGTGATGCCTACGTTACTGATTTTCCACTT
gtgagtctcttcttttatttaaaatacagtgatatattctcacttattaaagactaaatt
ttttaaaacttaaagttgatggtaaatataaaggaaatatatatatttatatatgtgtat
atatttatagtttagtaacactgatcataatatttactaattgccaaaataccttaagtt
EXON 15  126 bp
tattataaccatagattgttgttttcattgtttagtcctggataattttgggattaccaa
aattcacgagaggccagaattcacgagaggatagtatcagttaagatgtcttatgtacta
gattatattgtggctttcattgatttcattattaacagtccctaatttttttttttacag
GATCTAGATATTGATCCAAAAGATGCAAATAAAGGCACACCTGAAGAAACTGGCAGCTAC
TTGGTATCAAAGGATCTTCCCAAGCATTGCCTCTATACCAGACTCAGTTCACTGCAAAAA
TTAAAG
gttactaccttttctgtttatagctactaatggaaaactttatgaaactggaaacttatt
ttggcatagaccatagatatgctgccttattattaaagtagagataaccagtctacagaa
ggtcctatcagtgaccctttttatattctgtttccgatggtgaccagaggactttatgtg
EXON 16  2734 bp
ataatgatagctggcgtttctcagtttcagggagatataaaggatgccttgaggatttgg
aacctgggaaaggagagtgagtggatttttgggggtgggggtgtgtatgtgtgaatattt
tcagattgatatatattcactgttgatgccaataataaaccagatttttttccttttcag
GAACATCTAGTCTTCACAGTATGTTTATCATATCAGTACTCAGGATTGGAAGATACTGTA
GAGGACAAGCAGGAAGTGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGCATCGA
GGTTTGGGAAGGAAGACTTGCTTTCAAACTTGTCTTATGTCTAATGGTCCTTACCAGAGT
TCTGCAGCCACCTCAGGAGGAGCAGGGCATTATCACTCATTGCAAGACCCATTCCATGGT
GTTTACCATTCACATCCTGGTAATCCAAGTAATGTTACACCAGCAGATAGCTGTCATTGC
AGCCGGACTCCAGATGCATTTATTTCAAGTTTCGCTCACCATGCTTCATGTCATTTTAGT
AGAAGTAATGTGCCAGTAGAGACAACTGATGAAATACCATTTAGTTTCTCTGACAGGCTC
AGAATTTCTGAAAAATGACCTCCTTGTTTTTGAAAGTTAGCATAATTTTAGATGCCTGTG
AAATAGTACTGCACTTACATAAAGTGAGACATTGTGAAAAGGCAAATTTGTATATGTAGA
GAAAGAATAGTAGTAACTGTTTCATAGCAAACTTCAGGACTTTGAGATGTTGAAATTACA
TTATTTAATTACAGACTTCCTCTTTCTAAGATTTTGTGAATTGGTTGAATAGTTCTATAC
AAATGAAGTATGGAGGTGTGTATGTTTATATGTATATAACAAAATATTTTCATTGTGACC
ACTCTGAAGTAAGAGCAATGGGAATGGCATTATTGTAGAATAAGTCATTGTATTTTTAAC
ACCAGAAAGAACCTTGCCGATCACCAGGCATAACCTAATTTTATCCATGGAAGAAACACA
GAAAGGCATCTAAGTTAGAGCTGGCACCAGAACTGAGACCTCCAGAAATCTATTCCAGTA
TTTTTTCCACTACACAACTGCCTTCCTGACAGGTTCTGAGATAAGTGTTATGTTTGTAGA
TAGAGTGAAATATATTTATATATATATAAATATATACAGATACATATCTGTGTATTATCT
CAAGGAATGTACAAACTTTAGTTTTTGATTATAAGGACTTCACTGCAAGTTTTAGTTAAG
AGGTTTGTATATAAATCTGTTATAGAACAGGCTGAAATTTCTTGTTCATAAGATTATGAA
ACCACATGAGAAGTGATAAAATGTTTGTTAAAGCTAGATAGAGGTTAAGAATCAAGATAT
AATGGATAATTTTCATAGCTGCCTATCAGAATTTCCCAAATATTTAGCATCTTCCTTGAT
AATATGTATTTTCTTCTTGAATTTCACTGGCCTAATGAGATAATACTCTTATCTTTGGCT
CTACCTAAAAGTTGGTTAAAAATGCAATTGGCATTAACAAGGAAAAATACTGAATTAGTA
ATTTTAAAAGTCTCACAAAGAAAATCCCAGGCCTAGATGGCTGCATTGTTGAATTCTGCC
AAACATTAAAATTAGCACTAATTTTTTGCACACTGTTTCTAAAAGTAGGAGAGGAAAGAA
CACTTCCCAACTTACTCTAGGTCAGTATTACCCTGATACTAGACTAGACATCACAAGAAA
ACTATAAGCCAATATTCCTTATTAATACAAACACAAAAATCATTAACAAAAATATTAGCA
AACTGAATCCAGCAACCTATAAAAAGGATTCTATATCATGACCAAGTGGAATTTATCCCA
GGAATTCAAGGTTGGTTCAACATCTAAAAATCAAATAAGCTAATATACAGTCAGTTCTCA
TTATTCACAGTAATTATGTTCTACAGAATATTCTCCCATAAACACTGAATTAAATATGGA
ACAACTGCTTTTAGGAGAAAGTGTATTTGTGTATATGTGTGTATACATATGTTTATCTCA
CACACATTATGAGCTTGAATTCTTAATTCATCCTAGCAAATTCTACCTTATTTTACAGAA
GTGAAAGTGAGGTATCAGAAGTGTTAAGTGACATGCCTGAGGCACCCCCCTAACAGGTGT
CAGAGCTGAAATTCAAACCCCATCCAGCTGGCCCCGGAGCCAGAGCTTCTTGTACTACAC
AGAATTGCCCCTGCCATTTCCACCCTCCAGTCATTTCTCTATGAGACTGAAGCAGGAAGG
CAGAGCATCATCTTGTTCAGCCTCAGCTGGGAACATGTGTACTGGGTGACTCAAATTTTT
CACCCATTTACACATATCCACAAATGACTGCAAAAGTGCCACGGATATCAATTTGAGGGT
TATAAATTTTAGCAAGTTGGTAAATTCACAAATACATAACCTTGAATAATGAGGATCAAC
TGTACCATATTTAATAAAGCACAAAACCCACACAGATTGTCTTATTACAGCATTTGATAA
AATCCAAAACTCTTTCATAAAAACACTCAACAAACTTAGGAATAAAAGGAATCTTCCTAG
ATATGATAAATATAACATCTATGAAAAGCCCACACCTAACATTATACTTCATGGTGATAG
ACTGAAGGCTGAATGTTTTCCCCTTAAGATTGGGAAGAAGGACAAGGATGTTCACTCGGC
ACTACTTCTATTCAGCATTGTACTTGAAGTTCTAGCCACAGCAGTTAGGTTAGGAATTCA
AGGTTTGTTCAACATCTAAAAATCAAATAAGCTAATAAAGAAAAGAGGTTTATACTGCAA
AAGAAGTGAAACTATATGTATTCACAGTTGATACATAGTTGTATATAGAAAATGCTAAAG
AATCCATAAAAAGTAATAAATGAGTTCAACAGGT
tgcaggatacaagatcagttttatttctctactaacagcaaacattctgaaaatgagaat
aaagaaatcctatatacagtagcatcaagaataaaactccaacacgtttaaagaaattaa
gatccagataaatggaaagacatccatgttcatggattggaagactgaatattggtaaga