Gene ACAA2 Variant 1
DNA : 30.03 KbNT_010966
mRNA : 1584 bp NM_006111
CDS : 1194 bp NP_006102
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  64 bp
agccccgtcccctgggctccctcgggctggggtgaggcgggcagcgctacgcgtggggta
ggaccatcttacgctgggaccccgccaaggagccccaggaagtaggtgaaagggcagggg
cgtggctctcggggcgccacccacgctcttgaaatctgggtgattgcgagcggccgctca
GCGTCCCCCACACCACAGACCCGCGCCGCCGACGACCCAGCAGCCGCCATGGCTCTGCTC
CGAG
gtgagcgcagccccctcctcctctcctcgcccctcggggtcctgccctccccaggccagg
cctccgcttccggccgccgcggagagtcggggtcgtggggtgaagttcactcaacctcct
cggttttggagcggacgtgataaaaacccagcccgaaaggcttgtttgggttaaggagaa
EXON 2  167 bp
aaactggtagtccttaagactctgcttccatgggtatgacttgttctaggtattattgcc
taacagaaatttccattatctaattttaaattgtgtaaggtttcacagtgagattattcg
aagcatttagaggtatttactaacctgtgatggcttacaaatctcttcttgttgcaatag
GTGTGTTTGTAGTTGCTGCTAAGCGAACGCCCTTTGGAGCTTACGGAGGCCTTCTGAAAG
ACTTCACTGCTACTGACTTGTCTGAATTTGCTGCCAAGGCTGCCTTGTCTGCTGGCAAAG
TCTCACCTGAAACAGTTGACAGTGTGATTATGGGCAATGTCCTGCAG
gttagtagagtaaaggaaggtgttcactcctattgcttctttgatcagtttctaaaaata
attcctttaacatatcataatggtaaacaagttaataatagttatagacttttttttttt
ttttttgagatggagtctcgctctgccgccaggctggagtatggtggtgcgatcttggct
EXON 3  129 bp
tattcaaattgtaaacacatattagatataatatgctgtacttagatgcattttgtccta
ccttagagccatatagtttatcatttttgatagattgccaacatttccatgtatttcgtg
cttgttcttaattagtagatttatagagaaaattatttttcttttccttctctcttctag
AGTTCTTCAGATGCTATATATTTGGCAAGGCATGTTGGTTTGCGTGTGGGAATCCCAAAG
GAGACCCCAGCTCTCACGATTAATAGGCTCTGTGGTTCTGGTTTTCAGTCCATTGTGAAT
GGATGTCAG
gtatggacaacatttttttaaattctctgaaaatatgttaatagttactagaagaaatgt
cccactgcaatataacactttagctttagggaggattgcttgagccctggaggtcaagta
aaccatgatcataccactgcactccagccatgggcaacagagtgagaccttggctccaaa
EXON 4  117 bp
tggtaatggatactttagcatttgctttacagttactttaaaagcatttccttttgagac
actgtaagctacagtacaatatttgtttgatttaccattaatttgtaaaatcagtgtgtt
tcttaatacattgtttgggtacggtaaaaggagtttttattactgtttgtttttaaatag
GAAATTTGTGTTAAAGAAGCTGAAGTTGTTTTATGTGGAGGAACCGAAAGCATGAGCCAA
GCTCCCTACTGTGTCAGAAATGTGCGTTTTGGAACCAAGCTTGGATCAGATATCAAG
gttggaaccataaaaatttaaaagaattagttcttattagcattatataagtacttttaa
taacatacctttttatgggagagaaaactaattttgaagccaatttcgttgatgaggatt
ggcaagatatgaatgattagaagtttgtaaactatttcaaaactctattttggtggttag
EXON 5  148 bp
gttttcaaaaacattgcatgtttttaaaaaatatcccataactgaatatgaatagtggtt
atcagaaagtcttaattttacttttgtttattggaagtgttgattatttaaagaaattat
aacatattacttttaaaaggaaatgccttaacaagtcactttattaatgtcttttaatag
CTGGAAGATTCTTTATGGGTATCATTAACAGATCAGCATGTCCAGCTCCCCATGGCAATG
ACTGCAGAGAATCTTGCTGTAAAACACAAAATAAGCAGAGAAGAATGTGACAAATATGCC
CTGCAGTCACAGCAGAGATGGAAAGCTG
gtgagtgaaactggaaagtatcagtatctatagaataaatatctataggaaatattttca
tcatttctattatggttatataatatttacaaatcatacctttaagaattattacatctt
ttcattattcctttgtctttagatgatcagatattttattaattattgcaaaattaacta
EXON 6  176 bp
gtgccgttgcactccagcccaggcgacaatgtgagactccatctcaaaaattaataaaga
ctcaatattaaagtagactgtgaggaaaaggtagatcagaaattaaattgaataatatgt
ttgatttattttcatgtttctctcttttattcttatgatagtctctctactatttttcag
CTAATGATGCTGGCTACTTTAATGATGAAATGGCACCAATTGAAGTGAAGACAAAGAAAG
GAAAACAGACAATGCAGGTAGACGAGCATGCTCGGCCCCAAACCACCCTGGAACAGTTAC
AGAAACTTCCTCCAGTATTCAAGAAAGATGGAACTGTTACTGCAGGGAATGCATCG
gttggtatcaccacacagattagcttgaattcttcctggtgtgttcaacaaaagtaatca
tgaagtatcttgtaaatactttttatgccagtctttagttgtttagcttaaactaatagt
gttcatattcaattaatttaggttttcatagacccacacaaaatcttttcatatttattt
EXON 7  130 bp
tattctgtgccttaaaaaatctccttcatccaccacagtaccacttttctaattgtatct
cacactgtgcactggcttcctatgtactgccatattcctaatactactagtccattagtt
caaactttgattaactggattattttagcctttagttaatctagtatttttattttcaag
GGTGTAGCTGATGGTGCTGGAGCTGTTATCATAGCTAGTGAAGATGCTGTTAAGAAACAT
AACTTCACACCACTGGCAAGAATTGTGGGCTACTTTGTATCTGGATGTGATCCCTCTATC
ATGGGTATTG
gtaagtttatagtaaaacaaactggttctataatatttctggaggtaagtcttctttggc
attcagagtcctgaaaaagtggccaaaccaaggtcacctgtagagaaaagaagattggta
atcagtttaaataaaaaatctttatgaagaactgtcctagacacaatagaaaaaccaaga
EXON 8  71 bp
ctttttctgcctctttatggtcacttcatttaataggtacggtcaaggtagtaagatttg
tggctactaataactgccgcattatttcttccttacttggaaagaaggagaagcttgata
cgtaaatataagatgacatttatttctatatttttatagaagatttttattattatatag
GTCCTGTCCCTGCTATCAGTGGGGCACTGAAGAAAGCAGGACTGAGTCTTAAGGACATGG
ATTTGGTAGAG
gtaagtgtttttttttttttttttttttttaacaacatgaataaaccatgtacttttata
gcataaatgactttaatttggtctcattgctctttgaatttcattgtagttagcctttcc
aaatgatgtacatctaaataaatagtaccttcattagatgccttgtgttgatacttttcc
EXON 9  155 bp
aaatatacacattttaaacctgatagctttatgcagaatgattgtagataaaataacttt
gcgaggtaatttaaataggaagaaacagcagacttagctgttgataggactggaccattc
tcatttaaaaattagtttgtgagtaaggatttttgttagtgctctaatttttgttttaag
GTGAATGAAGCTTTTGCTCCCCAGTACTTGGCTGTTGAGAGGAGTTTGGATCTTGACATA
AGTAAAACCAATGTGAATGGAGGAGCCATTGCTTTGGGTCACCCACTGGGAGGATCTGGA
TCAAGAATTACTGCACACCTGGTTCACGAATTAAG
gtatttgctagaaatagctgcatttcagatttgctgttttttatagaaatgcatggattt
aggcttccccagaacactccaacatttttcattcttcttcatgtctcctgcactggctgt
taccaggaacaagttacttgggcagtgcttttcatctggtctcatagatgagtcagtcac
EXON 10  427 bp
aaaactttcagctttccaaagtctgttgcctgttgtaattataccaaaattgaggactgg
ggaaaagattgagcagatgagctgaataaggatgagtaatgcagatgtgatgttattagt
tctatttcattaatctgattttttattagagtagatttcagtcactgctttctttttcag
GCGTCGAGGTGGAAAATATGCCGTTGGATCAGCTTGCATTGGAGGTGGCCAAGGTATTGC
TGTCATCATTCAGAGCACAGCCTGAAGAGACCAGTGAGCTCACTGTGACCCATCCTTACT
CTACTTGGCCAGGCCACAGTAAAACAAGTGACCTTCAGAGCAGCTGCCACAACTGGCCAT
GCCCTGCCATTGAAACAGTGATTAAGTTTGATCAAGCCATGGTGACACAAAAATGCATTG
ATCATGAATAGGAGCCCATGCTAGAAGTACATTCTCTCAGATTTGAACCAGTGAAATATG
ATGTATTTCTGAGCTAAAACTCAACTATAGAAGACATTAAAAGAAATCGTATTCTTGCCA
AGTAACCACCACTTCTGCCTTAGATAATATGATTATAAGGAAATCAAATAAATGTTGCCT
TAACTTC
agttaatattttcctgtcatttatatttttaaaaattttaaattgtgataagatacacat
tacataaactttaccatcttaacccttttttagcgtacaattcactggtattaagtacat
tcacatttttatacaaacatccccactttttatcaacagaactttttcagtcaccacaca