--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (37494 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6234       6333   1   Internal    100    75        Good
aatatggtcatgtctctctactttaaaattcttcagtagttccaacttctaaaaatagtt
tctggagactacagaaaaaactatccttaagcttttttttttttggctggcaatagttct
ttttttctgttttgttaagttagctacataatttaccttggtcttttttccctctgatag
GTGGTGTTACTATATTTGTGGCCTTATATGATTATGAAGCTAGAACTACAGAAGACCTTT
CATTTAAGAAGGGTGAAAGATTTCAAATAATTAACAATAC
gtaagtgtcatgaatattttgtgagagaaatactgacagaaatctggtctttacacagga
accactgagctggttgatgatccagagatgagagaggtagggcatgggctgcccactgtg
tttaacgatgcattggcttctatagatgcatgttgcaacactgctgctgtagccagaagt

Exon  2 +       7446       7546   2   Internal    101   100   Excellent
atatgtcctttctcaagatgcctttccttaacattcttcctcccctgcctggcccagtcc
ttatcccctgctggattaagtatctctcttaggtgtttacatagcaccctatgcaaacct
caatcatagctgtcatcacattttgaattacaatttgtcacttgcttgttattcttttag
ACCAATGGTTCTCAACCTGGGACAGAATCACCCAGGGGATATTTGGCAGTATCTGGAGAC
ATTTTTGGTTGTCACAGTTGGGGTGCTGCCGCTGTCTTCTA
gtgagtagtggccagggatattggtaaatatcttaaaacgcacacagcagcctcccacaa
caaagaatgatcaagtccaaggtgtcaatagtgctgaagttggaaaacccagctctagac
tgtgaattccttgaagtcaaggactgtctttttacttttatttccagcacactctaaagt

Exon  3 +       7613       7723   0     Single    111    45    Marginal
gttattcttttagaccaatggttctcaacctgggacagaatcacccaggggatatttggc
agtatctggagacatttttggttgtcacagttggggtgctgccgctgtcttctagtgagt
agtggccagggatattggtaaatatcttaaaacgcacacagcagcctcccacaacaaaga
ATGATCAAGTCCAAGGTGTCAATAGTGCTGAAGTTGGAAAACCCAGCTCTAGACTGTGAA
TTCCTTGAAGTCAAGGACTGTCTTTTTACTTTTATTTCCAGCACACTCTAA
agtctgtcacttaataggtattcagtaaatgttagagtgaatcaatgaatgcttagcagg
atcaaatacaaggtttttggtttgtgtatctgaaagtgcttagtatatatgaggaaccac
aaaccaagtgtatgagtttctaaatatttgaattattaagggatttttcattcattttct

Exon  4 +      12181      12330   1   Internal    150   100   Excellent
aaatggggagaaaagatgctgaaagattacttttgaatcctggaaatcaacgaggtattt
tcttagtaagagagagtgaaacaactaaaggtatgaatattgttatattagtataagtat
aaaatttcttggggcagtattttgagaaagatatagtgaaagtatttatttttcacccag
GTGCTTATTCCCTTTCTATTCGTGATTGGGATGAGATAAGGGGTGACAATGTGAAACACT
ACAAAATTAGGAAACTTGACAATGGTGGATACTATATCACAACCAGAGCACAATTTGATA
CTCTGCAGAAATTGGTGAAACACTACACAG
gtatgtgaatatttcaaaggtaaaaattatttcttcatattctagtttatgaggacaaaa
tccatatcctcatttctcttaagatttaacacacttatttacacataatacatgcccaat
aaatgtctgttgtattctaaagggaggaacaggtaatacttagtacttgcattgtgctac

Exon  5 +      14941      15131   1   Terminal    191   100   Excellent
tcggcgaagtgtggatgggtaagaagcctgaatttttgttttctgtcattgtttagctgt
ggattaaagtgcaacaatttatgataaaatatgtttcaatatttaagagaagtgctgttc
actgaagtttggtctaaaatcctttaaaatataaattcctaaaatgtgttatttctttag
GAACATGGAATGGAACCACGAAAGTAGCAATCAAAACACTAAAACCAGGTACAATGATGC
CAGAAGCTTTCCTTCAAGAAGCTCAGATAATGAAAAAATTAAGACATGATAAACTTGTTC
CACTATATGCTGTTGTTTCTGAAGAACCAATTTACATTGTCACTGAATTTATGTCAAAAG
GTATGTATTAG
tatctccttaggtatttgtgttgataatgtttttaagagtcttgatttgtatgcatatag
acttatactgttttctaatttaagatttttatgtagacatatttggatagaagaaacctg
acactttgtttaatggaatagtgattatccagttattccagaggatagtatgacgtttaa

Exon  6 +      17075      17099   0    Initial     25    51    Marginal
ggcagatcacttgaggtcaggagttcgatcccagcctggccaacatagcgaaaccccgtc
tctgctaaaaatacaaaaaacagctgggcgtggtggcttgtgcctgtagttccagctgct
cgggaggctgaggcacgagaatggcttgagctagggaggcagaggttgcagtgagccaag
ATGACACCGCTGCACTCCAGCCTGG
gtgactgagtgagactccgtttcaaataaataaagactttaacaattaaaaaagatattg
gaacataagaaatataatgaaggtaaggctaatagcccatttagctctgtatattaattt
taagaattatttaattgggagaacatggtaaaattctgtgttgtcagaccactgggtaca

Exon  7 +      25054      25204   0    Initial    151    82        Good
taatcaggaagaaatgtgatttatttcaatatgaattttaaaaattaaagaatttttatc
ccatgtatcttgtacatttaaagaattgacactgatgactacagtagagatattgacaga
acattagccctgcatatgctatgtttacacaaatagatttttaaaaaacaattaagcaag
ATGGTCAACATTATTTTAGGTGCAAAATTTCCAATCAAATGGACAGCTCCTGAAGCTGCA
CTGTATGGTCGGTTTACAATAAAGTCTGATGTCTGGTCATTTGGAATTCTGCAAACAGAA
CTAGTAACAAAGGGCCGAGTGCCATATCCAG
gtaagcttgcattttatagctcttggttatctcatgagtggctttatcaggagtttatta
ggaacagaattgtaagcggggaaaaggcctttatttcttctcatagtccccctgcctctc
cctctccccactccttccctttactgtggcattggatgggtaactgtggcattggacggg

Exon  8 +      33406      33614   1   Terminal    209    98   Excellent
attagcattttctaagctcttcttgatattctcatgtttaaaatttattttgttgctttg
ttaaaagaattgtttcactaaataatatactttgaatgagttagtggctagggggtttgt
tatgttttcctagtggtagttaggaccattgttctttaatgttttaatcttgtgtattag
GTATGGTGAACCGTGAAGTATTAGAACAAGTGGAGCGAGGATACAGGATGCCGTGCCCTC
AGGGCTGTCCAGAATCCCTCCATGAATTGATGAATCTGTGTTGGAAGAAGGACCCTGATG
AAAGACCAACATTTGAATATATTCAGTCCTTCTTGGAAGACTACTTCACTGCTACAGAGC
CACAGTACCAGCCAGGAGAAAATTTATAA
ttcaagtagcctattttatatgcacaaatctgccaaaatataaagaacttgtgtagattt
tctacaggaatcaaaagaagaaaatcttctttactctgcatgtttttaatggtaaactgg
aatcccagatatggttgcacaaaaccacttttttttccccaagtattaaactctaatgta

--------------------------------------------------------------------------------