--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (18241 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1293       1497   0    Initial    205    79        Good
gggggccgccgcgaccccgccgagcaggaagaggcggagcgcgggacggccgcgggaaaa
ggcgcgcggaaggggtcctgccaccgcgccacttggcctgcctccgtcccgccgcgccac
ttggcctgcctccgtcccgccgcgccacttcgcctgcctccgtcccccgcccgccgcgcc
ATGCCTGTGGCCGGCTCGGAGCTGCCGCGCCGGCCCTTGCCCCCCGCCGCACAGGAGCGG
GACGCCGAGCCGCGTCCGCCGCACGGGGAGCTGCAGTACCTGGGGCAGATCCAACACATC
CTCCGCTGCGGCGTCAGGAAGGACGACCGCACGGGCACCGGCACCCTGTCGGTATTCGGC
ATGCAGGCGCGCTACAGCCTGAGAG
gtgacgccgcgggcccctgcgggacgggtggcgggaaggagggaggcgcggctggggaga
gcgctcgggagctgccgggcgctgcggaccccgtttagtcctaacctcaatcctgcgagg
gaggggacgcatcgtcctcctcgccttacagacgccgaaacggagggtcccattagggac

Exon  2 +       1649       1719   1   Internal     71    68    Marginal
cggcatgcaggcgcgctacagcctgagaggtgacgccgcgggcccctgcgggacgggtgg
cgggaaggagggaggcgcggctggggagagcgctcgggagctgccgggcgctgcggaccc
cgtttagtcctaacctcaatcctgcgagggaggggacgcatcgtcctcctcgccttacag
ACGCCGAAACGGAGGGTCCCATTAGGGACGTGACTGGCGCGGGCAACACACACAGCAGCG
ACAGCCGGGAG
gtaagccgcgtcccagcggctccgcggccgggctcgcagtcgccccagtgatgccgtggc
ccccgaggcgggcgtcatcgggcagcgtttgcccagtgctggagggttagggagagctgc
ctgggcttgaccgcgcgccggtctcaaagtcctggctttggcccctcctccgttttcccc

Exon  3 +       5696       5870   0   Internal    175   100   Excellent
caagagcgaaactctcaaaaaacaaaaaaaaggatgggttccatatgggtggtgtcaagt
gcccacctcctagcaagtcagcaggggccagaggcccttgtaagtggtgtctcgggggga
tcaactgagatggcttaggatttacctggatgcctgctctgctctccccatctcttccag
GGATCCACAAATGCTAAAGAGCTGTCTTCCAAGGGAGTGAAAATCTGGGATGCCAATGGA
TCCCGAGACTTTTTGGACAGCCTGGGATTCTCCACCAGAGAAGAAGGGGACTTGGGCCCA
GTTTATGGCTTCCAGTGGAGGCATTTTGGGGCAGAATACAGAGATATGGAATCAG
gtgaggagatagaacaatgccttccatttcccgggtgcccttcctagcatgtgtttgctc
cgttgttttagataaggtctgggggatgagtcaatgtcacaggagctgatgtatagcttt
gaccttgtgaggggtggtgccaggttaagccacaattaagcctcatgaaggccgtttcac

Exon  4 +       7125       7159   2   Internal     35    68    Marginal
cattgtagattctggatattagctctttgtcagatgagtaggttgcaaaaattttctccc
attttgtgggttgcctgttcactctgatggtagtttcttttgctgtgcagaagctcttta
gtttaattagatcccatttgtcaattttgtcttttgttgccattgcttttggtgttttag
ACATGAAGTCCTTGCCCATGCCTATGTCCTGAATG
gtaatgcctaggttttcttctagggtttttatggttttaggtctaacgtttaagtcttta
atccatcttgaattgatttttgtataaggtgtaaggaagggatccagtttcagcttttta
catatggctagccagttttcccagcaccatttattaaatagggaatcctttccccattgc

Exon  5 +       8409       8589   2   Terminal    181    74        Good
tgaaatatgtcccatcaatacctaatttattgagagtttttagcatgatgtgttgttgaa
ttttgtcaaaggccttttctgcatctattgagataatcatgtggtttttgtctttggatc
tgtttatatgctggattacatttattgatttgtgtatattgaaccagccttgcatcccag
GGATGAAGCCCACATGATCATGGTGGATAAGCTTTTTGATGTGCTGCTGGATTCGGTTTG
CCAGTATTTTATTGAGGAATTTTGCATCAATGTTCATCAAGGATATTGGTCTAAAATTCT
CTTTTTTGGTTGTGTCTCTGCCCAGCTTTGGTATCAGGATGATGCTGGCTTCATAAAATG
A
gttagggaggattccctctttttctattgattggaatagtttcagaaggaatggtaccag
ttcctctttgtacctctggtagaattcggctgtgaatccatctggtcctggactcttttt
ggttggtaagctattgattattgccacaatttcagctcctgttattggtctattcagaga

Exon  6 +      10299      10838   0     Single    540    93   Excellent
cagagaccagcaacctggagagcaggtgtctcatctaaggggacagtcacatttcacctc
cagccacctggaggaatttgggcctggtgatgtcagaattcttcaataaaagcctaaaat
ctatattttatgtgcggtcatgagatctgttaaatgttagcaacttcaggaagtttaaaa
ATGCTGTGTGGACCTAGAATAGGCAAGTTCTTAAAGGCAGAAAGTGGAATGCTAGTTTCC
AGGGACTGGGGAACAGGGAGGAATGGGGAGTTCATGTTTAATGGGCACAGAGGTTTTGTT
AGGGATGACGAAAAAGTTCGGGAGATGGTGATGGAGATGGTGATGGTGATGGAGATGGTG
ATGGTGATGGAGATGGTGATGGTGATGGAGATGGAGATGGTGATGGAGATGGAGATGGTG
ATGGTGATGGAGATGGTGATGGTGATGGAGATGGAGATGGTGATGGAGATGGTGATGGTG
ATGGAGATGGAGATGGTGATGGTGATGGAGATGGTGATGGTGATGGAGATGGAGATGGAG
ATGGTGATGGTGATGGTGATGGAGATGGTGATGGTGATGGTGATGGTGATGGAGATGGTG
ATGGTGATGGTGATGGTGATGGAGATGGTGATGGTGATGGTGATGGAGATGGTGATGGTG
ATGGAGATGGAGATGGTGATGGTGATGGTGATGGAGATGGTGATGGTGATGGGATGGTGA

tggagatggtgatggtgatggtgatggagatggtgatggtgatggagatggtgatggaga
tggtgatggtgatggagatggtgatggtgatggtgatggtgatggagatggtgatggtga
tggtgatggtgatggtgatggagatggtgatggtgatggtgatggtgatgatggagatgg

Exon  7 +      10832      11168   0    Initial    337    88        Good
gatggagatggtgatggtgatggtgatggagatggtgatggtgatggtgatggtgatgga
gatggtgatggtgatggtgatggtgatggagatggtgatggtgatggtgatggagatggt
gatggtgatggagatggagatggtgatggtgatggtgatggagatggtgatggtgatggg
ATGGTGATGGAGATGGTGATGGTGATGGTGATGGAGATGGTGATGGTGATGGAGATGGTG
ATGGAGATGGTGATGGTGATGGAGATGGTGATGGTGATGGTGATGGTGATGGAGATGGTG
ATGGTGATGGTGATGGTGATGGTGATGGAGATGGTGATGGTGATGGTGATGGTGATGATG
GAGATGGTGATGGTGATGGTGATGGTGATGGTGATGGAGATGGTGATGGTGATGGTGATG
GTGATGGAGATGGTGATGGTGATGGTGATGGAGATGGTGATGGTGATGGAGATGGTGATG
GTGATGGTGATGGTGATGGTGATGGTGATGGAGATGG
gtgatggtgatggttgcctaacatcaggaacgtgcttaatgcttctgaattgcacacaaa
aatggcaagtttaatattatgtgtactttatcacaatgaaaaaagctgctgcgtgggcca
agttacttgtgcaggtaagtgttctgcaggtcgttgcctgcacctcagttgtagggtgtc

Exon  8 +      12622      12723   1   Internal    102    86        Good
acagggccttgaactcaacccaccgagatctgcaaactttgcaggatgcaccagatgtct
tgtagccatgggtcaaggggggaccctgggtaagagactgtaatagatgacctctaaggc
catctcatgacatgtgtgattaatgtatgtacctgtcctctctttttgacaattctacag
ATTATTCAGGACAGGGAGTTGACCAACTGCAAAGAGTGATTGACACCATCAAAACCAACC
CTGACGACAGAAGAATCATCATGTGCGCTTGGAATCCAAGAG
gttgaaagaaccccgtcgtcttcatttatactaaccatactcttagagggaagcaatctg
gttttgtgcagaggcacctgagggaggcaggaccctgggaacttcccccagccacatggt
tgattgtgtgacgttgggcaagtcacattttgctgcactttcaccttcagatcatgaggt

Exon  9 +      14242      14417   1   Internal    176   100   Excellent
tctccctcagctccgtgccatcgctgcagaggctgttatggacatcactgcagcccagtg
gctctctctcctggtctccaccatatgagttggcttctgtttctctcctgttttactttg
cctttagctgtggtctttcaaaccaccatccctccttatcttcctctgctggttcctcag
ATCTTCCTCTGATGGCGCTGCCTCCATGCCATGCCCTCTGCCAGTTCTATGTGGTGAACA
GTGAGCTGTCCTGCCAGCTGTACCAGAGATCGGGAGACATGGGCCTCGGTGTGCCTTTCA
ACATCGCCAGCTACGCCCTGCTCACGTACATGATTGCGCACATCACGGGCCTGAAG
gtgggctgtctcgggaagggtgacttgccagcctaccacactgagctcttcagttcttta
atatgggaaaacaaattgcagagtttagtctctgattagcttttaaatttgatatgtgta
agtaagaaatgaaccagcttttactttgaaaccttcctcttctggaaggttttctggccc

Exon 10 +      16410      16547   0   Terminal    138    86        Good
gagaacagctggttgcgctccaatcatgttacataacctacggcaaggtatcgacaggat
catactcctgtaaaatagaactttgttgatcacatcctgtgtacttgtttcacggacatg
aggagcaattacaacaggtcgtacaattatggcaaaataatggccttattttgtttttag
CTTCAGCGAGAACCCAGACCTTTCCCAAAGCTCAGGATTCTTCGAAAAGTTGAGAAAATT
GATGACTTCAAAGCTGAAGACTTTCAGATTGAAGGGTACAATCCGCATCCAACTATTAAA
ATGGAAATGGCTGTTTAG
ggtgctttcaaaggagctcgaaggatattgtcagtctttaggggttgggctggatgccga
ggtaaaagttctttttgctctaaaagaaaaaggaactaggtcaaaaatctgtccgtgacc
tatcagttattaatttttaaggatgttgccactggcaaatgtaactgtgccagttctttc

--------------------------------------------------------------------------------