--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9394 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        873        982   1   Internal    110    51    Marginal
cttgttatacagaaaaattactaaggaaattcataggatgacaaaaactttcagaactga
aaaacaggaaatgtaagctttttagttctttggtattcgaagtatgcctaaaagacaatg
caaaatccaagaaaagaatggtggggtttttgtttgtttgtttttgtttttgttttacag
CTGGAGTAGAATACAAAGGGATGGAGTTGAAACAAATGAGAGGAAATTGGAATTCTAAAC
TTATTCTCATTGGCATTAGAAAGGCACCTACATGTATTTCACATGAGCCG
gtgactgctgacttgcattcttattttttccctatagattaaaaaggaggtacaatggta
gaactgtaatcctgtcctttgtcataaattttcatattcataaaggtgagtgttagcccg
cttgtgaaatctgaagttgagtaacttcaaatactaaccacagagggaaaggcagcaaga

Exon  2 +       1835       2113   0   Internal    279    97   Excellent
ttttgtaagccttctaattaggacattaatatatttaatatatgcacattgtagaaagat
tgaagcgttaaaaataagagaaaaactttaaatgtcaaaatctcacaacccagatatatc
atttctttaagaaaattgtactacaaaataccattccatttattaaagtcattctgacag
GAATCTGATGCTTTTCCAGGAGTTCCAGATCACATCGAGTTCACCATGAATTCACTCAGT
GAAGCCAACACCAAGTTCATGTTCGATCTGTTCCAACAGTTCAGAAAATCAAAAGAGAAC
AACATCTTCTATTCCCCTATCAGCATCACATCAGCATTAGGGATGGTCCTCTTAGGAGCC
AAAGACAACACTGCACAACAAATTAGCAAGGTAGCTATCAGCATCATTACGTTGTCCTGT
TGCAGTTTTTCTCTGGTTCCGTCGGCTAGCACGCAGATG
gtaatagatgtggtggtctgatgggtagcacagggggctgtgcaggaattcccataactg
tgagaccactgacttaaacagatcttttgagtaaagttttcttgtcccgcttcatgtctc
ttccaggttcttcactttgatcaagtcacagagaacaccacagaaaaagctgcaacatat

Exon  3 +       2240       2296   0   Internal     57   100   Excellent
attacgttgtcctgttgcagtttttctctggttccgtcggctagcacgcagatggtaata
gatgtggtggtctgatgggtagcacagggggctgtgcaggaattcccataactgtgagac
cactgacttaaacagatcttttgagtaaagttttcttgtcccgcttcatgtctcttccag
GTTCTTCACTTTGATCAAGTCACAGAGAACACCACAGAAAAAGCTGCAACATATCAT
gtgagtcacagagcactatggttcagctttagatccctgaacaggtcatagtttaaacct
ggaacttcacaaaaactaagaaaaggccagttttagggaaaatcttggacacaaagattg
agacatacagagtgggttggcatttcatggcacataattattattcctcatttctgcgtt

Exon  4 +       3577       3697   2   Internal    121    92   Excellent
taaggtggattttgaagggtatttgaggtgaaatacaccaattatcagggaataacatca
aaggtcctcaatgagactaccagcatttagggactgatctaacagacttagcatgggttt
agtatttacattgatacagcaattgaatgatctccctttttgatgtttgaaggttgatag
GTCAGGAAATGTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACAAATCCACTGA
TGCATATGAGCTGAAGATCGCCAACAAGCTCTTCGGAGAAAAGACGTATCAATTTTTACA
G
gtaatttcacctggcctacccacatttcatttgcatcctgatgtctgtgtctctgagtgg
ccaaatggaagaaagcaaggcagatgagcctggccgactcaggtggagagcatttactca
gagtgcattagctccatttccacaactctcccccactggagtgtcccagaccccaacgat

Exon  5 +       5681       5823   1   Internal    143    58    Marginal
gaaagctgcatctggtgaaccactggtcagtgagtctaacaattcaaagatcaaagtcag
tgagtctcaagcagggatttgggtcaataattaacgatcagtcacgaacatttgcaaagc
atcttccagacaagccatttgtagcttgtgtaaaagactcttttattctttcccttgcag
AAAAAATTAAAAACCTATTTCCTGATGGGACTATTGGCAATGATACGACACTGGTTCTTG
TGAACGCAATCTATTTCAAAGGGCAGTGGGAGAATAAATTTAAAAAAGAAAACACTAAAG
AGGAAAAATTTTGGCCAAACAAG
gtattgtctatattttatttatatagtgtaatatgttaatacatggaatgttaaacattt
ctgatggaatgtaacatgataagtaaaaaataaaaattgttcatgtctgttattttgttg
ttttactcttataactttatttagttaggaatacctgaaaaactattgtttctaactcat

Exon  6 +       6117       6272   0   Internal    156    97   Excellent
tttgttgttttactcttataactttatttagttaggaatacctgaaaaactattgtttct
aactcatggaattcctgggttatttcttagaagaagaaggatgtgttgctatctcaataa
tattatcttttttgtcttgtgtttcacgtgttatttgttggacacattgatttattgcag
AATACATACAAATCTGTACAGATGATGAGGCAATACAATTCCTTTAATTTTGCCTTGCTG
GAGGATGTACAGGCCAAGGTCCTGGAAATACCATACAAAGGCAAAGATCTAAGCATGATT
GTGCTGCTGCCAAATGAAATCGATGGTCTGCAGAAG
gtaagaacttgcatctacaactcttccttctactgccggacatttttccaaagataccaa
gtttaaacaaggtaaaagcttatgaccgagttgcctcaaaatgatgaaaaattctaaatg
aggaatgatgactcaccttcatattacaaatatttgagcatagggcctgacacaaactga

Exon  7 +       7334       7738   0   Terminal    405    88        Good
atgtatttatatattcaggactcatattttacctattagaataataatgtctattaaagt
gaaccttctgtatttcacatttattgccaaaataacgaatctccacatagtcaattcatt
gttaaggtgtattagagatcgacagttagtcatatcagtttcttttttccatttgtatag
CTTGAAGAGAAACTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGA
GAGACATGTGTCGATTTACACTTACCTCGGTTCAAAATGGAAGAGAGCTATGACCTCAAG
GACACGTTGAGAACCATGGGAATGGTGAATATCTTCAATGGGGATGCAGACCTCTCAGGC
ATGACCTGGAGCCACGGTCTCTCAGTATCTAAAGTCCTACACAAGGCCTTTGTGGAGGTC
ACTGAGGAGGGAGTGGAAGCTGCAGCTGCCACCGCTGTAGTAGTAGTCGAATTATCATCT
CCTTCAACTAATGAAGAGTTCTGTTGTAATCACCCTTTCCTATTCTTCATAAGGCAAAAT
AAGACCAACAGCATCCTCTTCTATGGCAGATTCTCATCCCCATAG
atgcaattagtctgtcactccatttagaaaatgttcacctagaggtgttctggtaaactg
attgctggcaacaacagattctcttggctcatatttcttttctatctcatcttgatgatg
atagtcatcatcaagaatttaatgattaaaatagcatgcctttctctctttctcttaata

Exon  8 +       8470       8518   2   Internal     49    54    Marginal
gaaaattaaaaacagagtagttcatgatgagcctggagtagaaggcatatcccagaacag
gaggagccttgtaaaccacataggaacttcctattttatgctaaagggataagaaactca
ttacaggctttgatggttgtttgtcaaagaggggcataaaattatcatatccacatctag
AAAATACATCTCTGGCTACGCTGATATCAATGGATGCGAGGAAAGAACA
gtgtggttaccatatataaattaggaaatcattagagtattgggagtggaaatggagaga
aagaaagagcctgggggaattatttaggaaataatagttacagaaagacatctaagttgc
tgacctatctgactggatggatggaagaatatcttgtttctgagagaaaaaaagactttg

--------------------------------------------------------------------------------