--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (18578 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4929       5109   0   Internal    181   100   Excellent
ggctgcacaggtggtatgtccatgaagctgtccctgacctgcctcatgttgttccatgag
gaagaacagacagggaatctgtccctacacagaatgcagcctgtcctactgttgctgacc
tcacccaaaatgttaccttatgtttcagagctgtttttttcttcctctctttgcttctag
ATTGAAACAATGGAGGATCTTTGTGTGGCAAACACACTCTTTGCCCTCAATTTATTCAAG
CATCTGGCAAAAGCAAGCCCCACCCAGAACCTCTTCCTCTCCCCATGGAGCATCTCGTCC
ACCATGGCCATGGTCTACATGGGCTCCAGGGGCAGCACCGAAGACCAGATGGCCAAGGTG
A
gtttgagctgaagctccacatttgggccgagtagttcctgaatggaattggagaactgct
cttgttttatgctaaagacattttaactcaggaggtcagcaatcatcacaggtaatgaag
cactgatccttacaacacaaattccttagattcaaatctataagacagccaagcccccga

Exon  2 +       6059       6154   0    Initial     96    58    Marginal
tacttcaattatacactgcaatcgttactgtaatagtcactcagcacatacaaaattctt
gtgatcatgttacttccaaggttagtgacctcgatgtggccatgatatcattaaaattcc
tttgcattcacacatacaaacattaacattaaatgctttaaggacacgcatgcattgtgc
ATGCAGTCACACCAAGATGCCGCCGGCTGGTTTCCAGTTTCCCACGAGAATGTACCTGAG
TGTAAATACATTCTTTCCATGCACATGGTGACCCAT
gtaaggtgggcctcatttgaagtttgaagtttcacagagagagcattggccaatattgct
gcaggaagacaagggatgggtgaatcaatctctgtgtttgtgacagtttaaacattgaga
cttacaacaaaactcaattgctcaactccctgacacaagtagtcttttgcaatattcttt

Exon  3 +       7867       8018   1   Internal    152    89        Good
atttaagggtcaatttccttggaagagaggaaaaccagccaagctgtcgtaggaaatctt
cttcttttacgtgagggtggagttgcaccacttcttttcagagagtactaggcaggactt
acgatgtatgactcaaagagcagaaaaagacctcacaaaccctaacacctctccttctag
CCCAGAAATTCACCAACTTGCTGGACAAGGCTGCCTTAATTAACTTCATTAGCAGAACCC
CAACCATCAAGCCACTTACCAGATCAGCTTCTCCTCAGGGACCCCATAGGGAGGTGCTGC
AGGACCAAGGGTTCCCAAGGAGGTGGGATGGG
gtgggtggctgggaggcagggccagcttgcaggtattaagactggcagaccaaggcgggc
aggcagcagtgttgtgggaaggggatctgaggaagcttcagaggggacagtccttgctgc
cagcttccccgtgtcagccaaaactgcctacttactatacgaagagattcacagtgtcat

Exon  4 +       8757       8850   0   Internal     94    97   Excellent
ttaggttggctgatacttttatattacacagaaagagtattgagtatctatggttgttcc
ccatgtataagggaagggaaaagatctaggaccattttagagccacctgatagccatctg
ttttaaaagttcagtaaatccgtgggcaagtgtaaccgttttctctaattctgattgcag
GTGCTTCAGTTTAATGAAGTGGGAGCCAATGCAGTTACCCCCATGACTCCAGAGAACTTT
ACCAGCTGTGGGTTCATGCAGCAGATCCAGAAGG
gtagttatcctgatgcgattttgcaggtatctgacttactggtccaaatttcttttgtgg
tttatttttgcaatcttcctgtcttaaagccacagtgtcagactgggaaggaagcgaata
taccctcccccattcacagaaagaaaactaagactcagagtcattaagaaaaacatgtcc

Exon  5 +       9660       9802   1   Terminal    143    46    Marginal
ctttcctcagtactccatttccttaaatgtcagctatccagttaaattataaaaactgag
tatagactgctcctgttggcaaccaacttccacagtcatgcttatgaggtagattatgaa
gaggtatctcccaaagctctcttcctgggcactctgaagctccttctacccattgcccag
GGAATTATGGGCTAGAGGAGGTGGACAGGATCCTGATCATGTGGAGATTCCGCCAGGTGT
TCTGTGGTACCTGGCAGTCCATCAGGAGGGCTCTGTCCCCTGCCCTAGGACAGGCTGCTG
CTGTGACCAAGCCCTGTGTCTGA
catggtgcttacaaacttcagtttgagaactgaaataaccattcacttttgtggttttct
aaaacccatgttttccactgcatagtttgccccataaaataggtatctagagaagctata
tgaactttgtaagatcattactaaggcaacatttcctccctgccagctttactgaggtat

Exon  6 +      10597      10712   1   Internal    116    86        Good
atccttatcgaaatgattttctcaaagattcctctaatgtaccaaaaataaagtatgtat
taatatagcatttcatgattgtattcaaaaactattaccatggcttaagaactatcttgt
ttagtagttctgtgttatatataaagaattccttctttcttttcaaggcacaagctgcag
ATAAAATCCATTCATCCTTCCGCTCTCTCAGCTCTGCAATCAATGCATCCACAGGGAATT
ATTTACTGGAAAGTGTCAATAAGCTGTTTGGTGAGAAGTCTGCGAGCTTCCGGGAA
gtaagtgaaacctgtaattgaaatggctggatcccaaacaagtaatgaagtcactttcaa
agcagttctctacaattcaacagttcataaaagcagagttggaattccacaccagctccc
tagggctggccttgcgtaacagctgcccttcctgtaccctctggggcttcctcctcttcc

Exon  7 +      15269      15375   1   Internal    107    93   Excellent
tttaaataaacctaaaaaactttagcttgaagattaacaactctgcaatttgaagaattt
agtttgatggctactcagaagattcagtaagtaatttcacagttcttgattatgaaacct
aaatatatgttatgttttctgtaggcaaaatcccaaacttgttacctgaaggttctgtag
ATGGGGATACCAGGATGGTCCTGGTGAATGCTGTCTACTTCAAAGGAAAGTGGAAAACTC
CATTTGAGAAGAAACTAAATGGGCTTTATCCTTTCCGTGTAAACTCG
gtatgagacaacaaaatacatcttcctagcatatattttagggcttttgacaagatatag
acagaaaaattagagaccgctcattatagacttgctagttagaagttatgcatgttggac
agttgattgactctttagaaacagtataggtaaaggggaagactgtggctttttaattat

Exon  8 +      15897      16061   0   Internal    165   100   Excellent
ttgaacaagctaataacatcagagtacccactgtaaggatgtacaaataatttattttgt
tgatttaaaaaaatcacatttatcctacactaaagtagaaccaatcctcctttatgtcta
attgtaaatctcttgatatcttataatcgacttccatattttaccttttaataatattag
GCTCAGCGCACACCTGTACAGATGATGTACTTGCGTGAAAAGCTAAACATTGGATACATA
GAAGACCTAAAGGCTCAGATTCTAGAACTCCCATATGCTGGAGATGTTAGCATGTTCTTG
TTGCTTCCAGATGAAATTGCCGATGTGTCCACTGGCTTGGAGCTG
gtaagacattcagatatttaagtttctggggctatacctacctttcgtgagatgagatga
atatatactccttacaaatggtgtggtaatttctcatggaaatatatgaaacagttgata
gtaaatatggcatgcctctacatttcattcaaagccttaactatgtcatacgtgttacct

Exon  9 +      16394      16798   0   Terminal    405    99   Excellent
agccttaactatgtcatacgtgttaccttcttgtaaaaatctgaccaatctgttaacttt
ctatatcacccacaatatagtaaagtcactgatttttaatattagacttaaagttgtttt
ccttctttctaatacttgctgtattttcttttgtttgttttgttttgttttgctttgcag
CTGGAAAGTGAAATAACCTATGACAAACTCAACAAGTGGACCAGCAAAGACAAAATGGCT
GAAGATGAAGTTGAGGTATACATACCCCAGTTCAAATTAGAAGAGCATTATGAACTCAGA
TCCATTCTGAGAAGCATGGGCATGGAGGACGCCTTCAACAAGGGACGGGCCAATTTCTCA
GGGATGTCGGAGAGGAATGACCTGTTTCTTTCTGAAGTGTTCCACCAAGCCATGGTGGAT
GTGAATGAGGAGGGCACTGAAGCAGCCGCTGGCACAGGAGGTGTTATGACAGGGAGAACT
GGACATGGAGGCCCACAGTTTGTGGCAGATCATCCTTTTCTTTTTCTTATTATGCATAAG
ATAACCAACTGCATTTTATTTTTCGGCAGATTTTCCTCACCCTAA
aactaagcgtgctgcttctgcaaaagatttttgtagatgagctgtgtgcctcagaattgc
tatttcaaattgccaaaaatttagagatgttttctacatatttctgctcttctgaacaac
ttctgctacccactaaataaaaacacagaaataattagacaattgtctattataacatga

--------------------------------------------------------------------------------