--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (27567 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1193       1307   0    Initial    115    93   Excellent
aaaaactcccgcacgtgggcctccacgattccttggcatgcgtgtcactctgggcaacag
gctggtcggccacgactgcgcaggcgagaggcacagagcgactggagactgtagtccccc
ggtttccctggagaccaggcggaagcggccggaagtagcgctgcggttggcagcggcggg
ATGGAGAAGCTGGGGGTGGAGCCGGAGGAGGAAGGCGGCGGCGACGACGACGAGGAAGAC
GCCGAGGCCTGGGCCATGGAACTGGCGGACGTGGGGGCGGCAGCCAGCTCGCAGG
gtgcgccgcagccagaggagccagcggcctccttgggtgtaaatgagaagggtggggcag
gcggacgctcggggcggcggccactggggcgcgaccgtccccgccccactcggctcctct
aagagagggctgcctccctctgccttgtgttacgcggcgggtacctctagaggaatggct

Exon  2 +       3006       3131   1   Internal    126    94   Excellent
gaccctaccctaagtggagtttcatgtctttgtaatttttcgatgctttcacacataatc
caggagaaaacacgtcactctgcattcttccttcacaggtaccatgttttaaggaactgt
cagttgctcagagataataagcagcctgaatttctttttatttctttgcatattgtgcag
GAGTTCATGATCAAGTGTTGCCCACACCAAATGCTTCATCCAGAGTCATAGTACATGTGG
ATCTGGATTGCTTTTATGCACAAGTAGAAATGATCTCAAATCCAGAGCTAAAAGACAAAC
CTTTAG
gtaactgtagatttataatatttttaattgcataatgattagattagcaactcatcatgc
tcattatatactgatttattaaccttattaagaaagattttggaagcagttcttacagtg
ctttatagctggtcatttttgcttcactaccaagtgtaaattttacaagcctcatttaat

Exon  3 +       5572       5736   1   Internal    165   100   Excellent
aatgtttctgcattatagagatttgatatatggaggctatgttttttaattgagacaggg
cttttgattcttatcaaaactgattgtcttacaatttagacaaatgtaatacggaattaa
taatatctttaaatgttttcttcaattgtgcttgggtttctcataaaatattttttacag
GGGTTCAACAGAAATATTTGGTGGTTACCTGCAACTATGAAGCTAGGAAACTTGGAGTTA
AGAAACTTATGAATGTCAGAGATGCAAAAGAAAAGTGTCCACAGTTGGTATTAGTTAATG
GAGAAGACCTGACCCGCTACAGAGAAATGTCTTATAAGGTTACAG
gtacaaatgataagcaatgtacttttagcattaatttttatgtaggatgcctgttcatta
catgaattttttaataaatgtaaaataacataagtcaagatgctttttcctaataacttc
ttattttgggtcttgtcaactttaaaaattatgtgaaaggataactgtatgctatgaata

Exon  4 +       9349       9501   1   Internal    153    87        Good
acaagatgtggtacagaaaaaacgtcaattaactgagggctttattaaagatattatgga
actatgaatgtatataaaacctttaacaataaatttgataaatttttaagcactagatag
ttaaatttatcctagttataacttcatttacatttgtgctccaatattatttcaatttag
AATTACTGGAAGAATTTAGTCCAGTTGTTGAGAGACTTGGATTTGATGAAAATTTTGTGG
ATCTAACAGAAATGGTTGAGAAGAGACTACAGCAGCTGCAAAGTGATGAACTTTCTGCGG
TGACTGTGTCGGGTCATGTATACAATAATCAGT
gtgagtgggttcttattcattctacctactaaccaaaagtacatacatttcttaatgttc
agtgagttcgctgtgtgattctgaaagattcatgacttttgttggaggtatagttatatt
tagtcagtaatctgtctaggacagctaaaattaggtgctgctattccataataagtgtta

Exon  5 +      12291      12549   0    Initial    259    58    Marginal
ccccacctccaacactggggatcaaattacaacatgaggtttggaggggacaaatatcac
aaccataccaggtgatgatggtggtggttgtggtggtggtggttgttggatatagactaa
gccctctaccttttaaaaattattttgtgaaaaagaaaaaggtttttcttgtgactttga
ATGACATTTGTTGTTTTTAAAGCTATAAACCTGCTTGACGTCTTGCACATCAGACTACTT
GTTGGATCTCAGATTGCAGCAGAGATGCGGGAAGCCATGTATAATCAGTTGGGGCTCACT
GGCTGTGCTGGAGTGGCTTCTAATAAACTGTTGGCAAAATTAGTTTCTGGTGTCTTTAAA
CCAAATCAACAAACAGTCTTATTACCTGAAAGTTGTCAACATCTTATTCATAGTTTGAAT
CACATAAAGGAAATACCTG
gtaagacaaatatatttgaaaagtacatatacgtcttattttatttcttttaatttaaaa
aattatagatacaatgtaattaattcttaggtagagttgtctgtgagtttgtgtgcatgt
gtgtgtgtgtgtatacttggttcctggaaaaaactaagaaaaactgtaatgttttctcaa

Exon  6 +      14483      14637   1   Internal    155    90   Excellent
tactgtccatggtttcaggcatccactgaaggtcttagaatgtatcccctgtggataagg
ggggactactgtataaattatagaacttaaagataagattgatatatttataatatttta
attagctttgttttaaggagaaaagctattttaacattgtatgcatttctttttatttag
GTATTGGCTATAAAACTGCCAAATGTCTTGAAGCACTGGGTATCAATAGTGTGCGTGATC
TCCAAACCTTTTCACCCAAAATTTTAGAAAAAGAATTAGGAATTTCAGTTGCTCAGCGTA
TCCAAAAGCTCAGTTTTGGAGAGGATAACTCCCCT
gtgatactctcaggaccacctcaggtacatgatgatacttattttaattaagtactggtt
atcacattatttgagataaagatttctagttttagtaccatgttcttactattctagttt
gcttagtatgtgatccctttcctattagaaggctgatttattattaatagattggattaa

Exon  7 +      15568      15659   0   Internal     92    82        Good
gtgagtacaatagcttgcagataaaaaactgttaatataaaagtgaactaaatggctcaa
actaaggacaagaggtaagttagtgaagaatgtattgaatatttatttgactgtacactg
ataataattagatatagttatttgagtttgtgctaatccttatttatgcttctttgatag
TCCTTTAGTGAAGAAGATTCATTTAAAAAATGTTCATCTGAAGTTGAAGCTAAAAATAAG
ATTGAAGAACTACTTGCTAGTCTTTTAAACAG
gtgattttcaatccattttgccaagtcatcctatgtattcattctatatacggtatgtgg
aaagaatatttgatgttccatcttggaactgacagattatctggagactaaacaatgtaa
aaataatttatcatgggatttctctgctttataaactgttgtaaagatggtaataggggg

Exon  8 +      18927      19057   2   Internal    131    73        Good
agactttgtgatgattatttggatactcagggacctttattgcttactattttgttatct
gctatatgtataattgtcatatttaacaaaatctggcacctttagataaatgagatgtta
cataatttaaaaaggtaatacttttctaattccttatttccactttctctttatttttag
AGTATGCCAAGATGGAAGGAAGCCTCATACAGTGAGATTAATAATCCGTCGGTATTCCTC
TGAGAAGCACTATGGTCGTGAGAGTCGTCAGTGCCCTATTCCTTCACATGTAATTCAGAA
ATTAGGGACAG
gtatggactagttttccaacagtttcattagcaggttgaactcttaaataagccaacttt
gaatgagaaatatgctccaaaaatggagggtcttcacagggaattagcaagcaattaaat
gcttttattctatcaggaattttcactggaaaactttgttgtttgtttatttatttattt

Exon  9 +      21596      22069   0     Single    474    45    Marginal
gccatatgtagaaagttgaaactggatcccttccttacaccttatacaaaagttaactca
agatggattaaagacttaaatgttagaactgaaatcataaaaaccctagaagaaaaccta
ggcaatagcatttagtacataagcatgggcaaagacctcatgactaaaacaccaaaagca
ATGGCAACAAAAGCCAAAATTGACAGATGGGACCTAATTAAACTAAAGAGCTTCTGCACA
GCAAAAGAAACTATCAGCAGAGTGAACAGGCAACCTACAGAATGGGAGAAAATTTTTGCA
ATCTACCCATCTGACAAAGGGCTAATATCCAGAATCTACAAAGAAGTTAAACAAATTTAC
AAGAAAAAAGCAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTTTCA
AAAGAAGACATTTATGCTGCCAACAGACATATGAAAAAATGCTCATCATTGCTGGTCATT
AGAGAAATACAAATCAAAACCACAATGAGATACCAGCTCATGCCAGTTAGAATGGCGATC
ATTAAAAAGTCAGGAAACAACAGATGCTGGAGAGGATGTGGAGAAATAGGAACACTTTTA
CACTGTTGGTGGGAGTGTAAATTAGTTCAACCATTGTGGATGACAGTGTGGTGA
ttcctcaaggatctagaactagaaataccatttgacccagtgatcccattactgggtata
tacccaaaagattataaatcatgctactataaagacacatgcacgcgtatgtttattgtg
gcactattcacaatagcaaagacttggaaccaacccaaatgtccatcagtaatagactgg

Exon 10 +      22277      22378   0     Single    102    42    Marginal
ccatttgacccagtgatcccattactgggtatatacccaaaagattataaatcatgctac
tataaagacacatgcacgcgtatgtttattgtggcactattcacaatagcaaagacttgg
aaccaacccaaatgtccatcagtaatagactggataaagaaaacgtgtcacatatacatc
ATGGAATACTATGCAGCCATAAAAAAGGATGAGTTCATGTCCTTTGCAAGGACATGGATG
AAGCTGGAAACCATCATTCTCAGCAAACTATCACCAGGATAG
aaaaccacacaccacatgttctcactcataagtgggagttgaacaacgaggacacatgga
cacagggaggagaacatcacacaccggggcctatctggatggagggctgagggagggata
gcattaggagaaatacctaatgtaaatgaagagttgataggtgtagcaaactaacacggt

Exon 11 +      23479      23543   1   Internal     65    66    Marginal
tatttcaaatcttttgaaaatttttaaccatttagtattaatattgaaatgtcttaattt
ggtatataatgtcaagatgcccagtgatatttaggattttaatttcttaatctcagcaat
ataaaatatattatgctcttaatattaattataatgtttattcttaaacattttatttag
GAAATTATGATGTGATGACCCCAATGGTTGATATACTTATGAAACTTTTTCGAAATATGG
TGAAT
gtgaagatgccatttcaccttacccttctaagtgtgtgcttctgcaaccttaaagcacta
aatactgctaagaaagggcttattgattattatttaatgccatcattatcaactacttca
cgctctggcaagcacagttttgtaagtacactcttttttgttcagttttctaagtatact

Exon 12 +      25295      26113   0   Terminal    819    73        Good
cacaaaatagtgtgaataattgtggtagtagatctctagttgtttggaactggccacaaa
gagttgtatttgttgagtaggttagaaacatgtcagataatagctacaggcacacagcag
cagcagcgatatttaaaagatatcagatatgtaaattagtctgttattcttgtgttctag
AAAATGAAAGACACTCATATGGAAGATTTTCCCAAAGACAAAGAAACAAACCGGGATTTC
CTACCAAGTGGAAGAATTGAAAGTACAAGAACTAGGGAGTCTCCACTAGATACCACAAAT
TTTTCTAAAGAAAAAGACATTAATGAATTCCCACTCTGTTCACTTCCTGAAGGTGTTGAC
CAAGAAGTCTTCAAGCAGCTTCCAGTAGATATTCAAGAAGAAATCCTTTCTGGAAAATCT
AGGGAAAAATTTCAAGGGAAAGGAAGTGTGAGTTGTCCATTACATGCCTCTAGAGGAGTA
TTATCTTTCTTTTCTAAAAAACAAATGCAAGATATTCCCATAAATCCTAGAGATCATTTA
TCCAGTAGCAAACAGGTATCCTCTGTATCTCCTTGTGAACCGGGAACATCAGGCTTTAAT
AGCAGTAGTTCTTCTTACATGTCTAGCCAAAAGGATTATTCATATTATTTAGATAATAGA
TTAAAAGATGAACGAATAAGTCAAGGACCTAAAGAACCTCAAGGATTCCACTTTACAAAT
TCAAACCCTGCTGTGTCTGCTTTTCATTCATTTCCAAACTTGCAGAGTGAGCAACTTTTC
TCCAGAAACCACACTACAGATAGCCATAAGCAAACAGTAGCAACAGACTCTCATGAAGGA
CTTACAGAAAATAGAGAGCCAGATTCTGTTGATGAGAAAATTACTTTCCCTTCTGACATT
GATCCTCAAGTTTTCTATGAACTACCAGAAGCAGTACAAAAGGAACTGCTGGCAGAGTGG
AAGAGAGCAGGATCAGATTTCCACATTGGACATAAATAA
gcatattcagcaaaaaggtctgaaaagcaagggaataccattattttcggattagcggtt
tattaagctcttctatattaaacactaatagatattcaataacggagtaaactgttccag
ataaagcaagaatagttgcaagaagtaaattctggcacaaagcgtaaaaatataacagaa

Exon 13 +      25880      26113   0   Terminal    234    64    Marginal
acatcaggctttaatagcagtagttcttcttacatgtctagccaaaaggattattcatat
tatttagataatagattaaaagatgaacgaataagtcaaggacctaaagaacctcaagga
ttccactttacaaattcaaaccctgctgtgtctgcttttcattcatttccaaacttgcag
AGTGAGCAACTTTTCTCCAGAAACCACACTACAGATAGCCATAAGCAAACAGTAGCAACA
GACTCTCATGAAGGACTTACAGAAAATAGAGAGCCAGATTCTGTTGATGAGAAAATTACT
TTCCCTTCTGACATTGATCCTCAAGTTTTCTATGAACTACCAGAAGCAGTACAAAAGGAA
CTGCTGGCAGAGTGGAAGAGAGCAGGATCAGATTTCCACATTGGACATAAATAA
gcatattcagcaaaaaggtctgaaaagcaagggaataccattattttcggattagcggtt
tattaagctcttctatattaaacactaatagatattcaataacggagtaaactgttccag
ataaagcaagaatagttgcaagaagtaaattctggcacaaagcgtaaaaatataacagaa

--------------------------------------------------------------------------------