--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (15030 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2660       2794   2   Internal    135   100   Excellent
aataggaaagaatggggtgagaatatgaggggtttcttttccatatatgggctggttgcc
tgtggcaggtcctagggcttgggcaagcactaatggataccagtgatttgtgtggcctgg
ggcacagtgttgtcccttcctagagcctcagtttccctcatcccttccaccccctttcag
GCTACTGCTGCTTCCTGTGGCCTCCATGGCTGAGGACTGGCTGGACTGCCCGGCCCTGGG
CCCTGGCTGGAAGCGCCGCGAAGTCTTTCGCAAGTCAGGGGCCACCTGTGGACGCTCAGA
CACCTATTACCAGAG
gtactgggtgggtagtgggcagagtcaggagtggggtagagcctgattctggtaaaatca
aatggtgtggttaaatttatggatgaagtttaaattatgcacatacagttaatccttatt
agcggattttatgtttgaatttcacctacttaataaaatttatttgtaacttaaaagtca

Exon  2 +       5473       5587   2   Internal    115    98   Excellent
atgtgttggtatttatattaatttttttatgttttcaaggttagttgaggtgggggctgg
gcagggctcacaagccaattccaggctgcctcctatatcctgccagccctgtcaaaaggt
tgtatgagtgaaatggcattggctccacctgggtgctaacccatcatggcccatccctag
CCCCACAGGAGACAGGATCCGAAGCAAAGTTGAGCTGACTCGATACCTGGGCCCTGCGTG
TGATCTCACCCTCTTCGACTTCAAACAAGGCATCTTGTGCTATCCAGCCCCCAAG
gtacttcacaacatgagatacctaggtaggggtggatgtgccacccaacacccaaccact
gacccatattcctccttcccttactttccaggcccatcccgtggcggttgccagcaagaa
gcgaaagaagccttcaaggccagccaagactcggaaacgtcaggttggaccccagagtgg

Exon  3 +       5679       5845   0   Internal    167    64    Marginal
aagttgagctgactcgatacctgggccctgcgtgtgatctcaccctcttcgacttcaaac
aaggcatcttgtgctatccagcccccaaggtacttcacaacatgagatacctaggtaggg
gtggatgtgccacccaacacccaaccactgacccatattcctccttcccttactttccag
GCCCATCCCGTGGCGGTTGCCAGCAAGAAGCGAAAGAAGCCTTCAAGGCCAGCCAAGACT
CGGAAACGTCAGGTTGGACCCCAGAGTGGTGAGGTCAGGAAGGAGGCCCCGAGGGATGAG
ACCAAGGCTGACACTGACACAGCCCCAGCTTCATTCCCTGCTCCTGG
gtgagtgttggtctaaggtgagccagatgggtgagggttgtgattgggggtgctcttgga
gccccacacctgcctttcccatcccaggtgctgtgagaactgtggaatcagcttctcagg
ggatggcacccaaaggcagcggctcaaaacgttgtgcaaagactgtcgaggtgagtggcc

Exon  4 +       5933       6015   2   Internal     83   100   Excellent
tggaccccagagtggtgaggtcaggaaggaggccccgagggatgagaccaaggctgacac
tgacacagccccagcttcattccctgctcctgggtgagtgttggtctaaggtgagccaga
tgggtgagggttgtgattgggggtgctcttggagccccacacctgcctttcccatcccag
GTGCTGTGAGAACTGTGGAATCAGCTTCTCAGGGGATGGCACCCAAAGGCAGCGGCTCAA
AACGTTGTGCAAAGACTGTCGAG
gtgagtggcctccagaggatggggcatcgggagataggagctggagcaggtccagtgtca
tgctaggctggggtttgaatgtggatgtcaggacagaggctactggcatggttggaggtt
ggatattggagatagcaggcataggtagaggttgaatagtggaagtcagggcacaggcag

Exon  5 +       6259       6400   1   Internal    142    93   Excellent
taggctggggtttgaatgtggatgtcaggacagaggctactggcatggttggaggttgga
tattggagatagcaggcataggtagaggttgaatagtggaagtcagggcacaggcagtga
gtgaagtcagatgtctgttgcttcctttccacttttcttcttccctcttcctccccacag
CACAGAGAATTGCCTTCAACCGGGAACAGAGAATGTTTAAGGTAAGCACAACCTGCTTCC
TCTTCACAACTCTGCAGTGGGAGCAGGATGTGATGGAGCTGGTAGAGTCTGAAGGGATGA
TGATGGGTCCACAGGATGAAGA
gtcattttatagggtgctctccataggtcagcagacacaataatgggaattaatggggta
attaatccccattaccattagtgcatcagtagacacagtgatgaagtgaacaggggacca
gtagacatactaatggcctcagtgatggtgactaaccagaccttctcagatacggtgatg

Exon  6 +       6696       6842   0   Internal    147    75        Good
gaccagtagacatactaatggcctcagtgatggtgactaaccagaccttctcagatacgg
tgatgaggctaatgggggactaaaattcatggtgatgccagctgatgtagggtcagtaga
catgggaggaccagtgcttctggagcaggcccgtgatctcgtccctaccattcctggcag
CGTGTGGGCTGTGGGGAGTGTGCAGCCTGCCAGGTAACAGAAGACTGTGGGGCCTGCTCC
ACCTGCCTCCTGCAGCTGCCCCATGATGTGGCATCGGGGCTGTTCTGCAAGTGTGAACGG
AGACGCTGCCTCCGGATTGTGGAAAGG
gtgagttgggcaagtggaaagagcccaaggctcacctcggcccctggcccccatgggctt
ggccccatgcttcatgcctctgctcccacctgccccccgccaacagagccgagggtgtgg
agtatgccggggctgtcagacccaagaggattgtggccattgccccatctgccttcgccc

Exon  7 +       6949       7077   2   Internal    129   100   Excellent
agctgccccatgatgtggcatcggggctgttctgcaagtgtgaacggagacgctgcctcc
ggattgtggaaagggtgagttgggcaagtggaaagagcccaaggctcacctcggcccctg
gcccccatgggcttggccccatgcttcatgcctctgctcccacctgccccccgccaacag
AGCCGAGGGTGTGGAGTATGCCGGGGCTGTCAGACCCAAGAGGATTGTGGCCATTGCCCC
ATCTGCCTTCGCCCTCCCCGCCCTGGTCTCAGGCGCCAGTGGAAATGTGTCCAGCGACGT
TGCCTACGG
gtgagttgggctggagggagcagagctcattctgctgttaaaatcgtcgctgcctctgct
tcctttcaacctggccttgcctacctcatgtctttcttttctgcctaaccctatgctcgc
ctttctggccccgcctacctgcctctgtctgccagcaccttgctcaccgcctgcgtcgcc

Exon  8 +       7233       7307   2   Internal     75   100   Excellent
atgtgtccagcgacgttgcctacgggtgagttgggctggagggagcagagctcattctgc
tgttaaaatcgtcgctgcctctgcttcctttcaacctggccttgcctacctcatgtcttt
cttttctgcctaaccctatgctcgcctttctggccccgcctacctgcctctgtctgccag
CACCTTGCTCACCGCCTGCGTCGCCGTCATCAGAGATGTCAGCGACGCACTCCCCTGGCT
GTGGCTCCCCCAACT
gtgagtgcctcacgccaccctctgtctgcctgtcccatgcatgctttctgcacttagggt
gtggggagtttctgtgtctgcctggtgccaccaagctgaaaccaccctttctgatctttc
ccagggtaaacatgcccgccgcaagggaggctgtgactccaagatggctgccaggcggcg

Exon  9 +       7632       7700   0   Internal     69   100   Excellent
gggaggctgtgactccaagatggctgccaggcggcgccccggagcccagccactgcctcc
accacccccatcacagtccccagagcccacagagccggtgaggccccagtgggtggaggg
aaggcacaaccctgaccttacccagtacctgccctgaccccaccccatttgcctctacag
CACCCCAGAGCCCTGGCCCCCTCGCCACCTGCCGAGTTCATCTATTACTGTGTAGACGAG
GACGAGCTA
gtgagtggccccaccctacctggataagcctagaatctcaggacgcttggttaacttcaa
agaagcagatgctggaatgagcctattggggaacagcaaggcacaataatgggtcctagg
atgggatgagtagataatggaggactaatacggggtcagcaggtgcatgagagtgcttca

Exon 10 +       8324       8481   0   Internal    158   100   Excellent
gccaatgttgaactagcgaatgctgaggagtgactagtggggagtcaggaggctgagact
agtatgcaagtagctccgtcttatggggctagaggagcaccaggaccagcactggaatag
gcgttgaggatggcctctcctagtcctagttgacagcaccacccattccccccaccccag
CAGCCCTACACGAACCGCCGGCAGAACCGCAAGTGCGGGGCCTGTGCAGCCTGCCTACGG
CGGATGGACTGTGGCCGCTGCGACTTCTGCTGCGACAAGCCCAAATTCGGGGGCAGCAAC
CAGAAGCGCCAGAAGTGTCGTTGGCGCCAATGCCTGCA
gtttgccatggtgggtggggcaggaagggtcaggtggacgggataggttgggccaggcgc
cccagtgcctggaagtggtgggcaggcttggtaggtgggtgggtggggcagtagctttgg
ttgaggattaacagacattgttcttggcttaatgagtctaggtggcattggtgttgctaa

Exon 11 +       9145       9343   2   Internal    199    58    Marginal
accatacccaggctccaacgaagcaggaagcaggtggtggctttgtgctgcccccgcctg
gcactgaccttgtgtttttacgggaaggcgcaagcagtcctgtgcaggtgccgggccctg
ttgcagcttccacagaagccctgttgcaggtgagggccccaccctgtcctgccttcccag
CCTCACCCAGCTGCATGCCAGGGAGCTGAGACCAAGTCTGCTGCAATCCTCCCTCACGCA
GGAGGCCCAGTGCTCTGGCCTGAGTTGGGTTGTGGCCTTACCCCAGGTGAAGCAAGAGAA
GGCGGATACCCAGGACGAGTGGACACCAGGCACAGCTGTCCTGACTTCTCCCGTATTGGT
GCCTGGCTGCCCTAGCAAG
gtgggggcagtgatggatgttctgttggtgccgtagcggagtggtctgtaagcagagtga
tgatgagccatgatggttctcttgagcagagcaatagatgtgctgattgcgacgtttctg
cagaattaccccgcctgtctaacagacaccctacctcccacaggcaactagctttgcccg

Exon 12 +       9722       9853   0   Internal    132    99   Excellent
agaaaaacggaggtcagtgaggaatgggaatgggaaagctttgtaggcagagagatggac
tttctgtgttgaaatgtgatggaagtaggatttgtcagcacagtgaggggttggctgata
gagactttcctcaggtgaactctgcccttctaatggttgcctgtttcctacttctcccag
GCAGTAGACCCAGGCCTGCCTTCTGTGAAGCAAGAGCCACCTGACCCAGAGGAGGACAAG
GAGGAGAACAAGGATGATTCTGCCTCCAAATTGGCCCCAGAGGAAGAGGCAGGAGGGGCT
GGCACACCCGTG
gtcagtgctggggatgccccaccctgccctgaccctgctgtagccccaacaaccacattg
acctatggtgttaattcttctctagatcacggagattttcagcctgggtggaacccgctt
ccgagatacagcagtctggttgccaaggtgtgccccacacagtgaggggtggggaaggag

Exon 13 +      12993      13089   2   Terminal     97    70        Good
gtctctgtaaggctgttgtctttgcatctaatgctggagcttgaagtctgcagggcaggc
actcgggaagggaagatggatgtaaagtgtgggagaccgaggacacagtggagcccacga
gcacgagctggaacccacgaggatggcctggaacccatgtcagtctctcaccacctccag
CTTCGATGATGTGGGTGTCCTGCAGAAGAAGCTGGTGCCCTTCCTCACAGAGTTAAATAT
GCATCTGGCCCAGGAATTAGAGAAGCTGAAAGGATGA
tcctggggaaggtggagcagctgcaggcctggctgcaggcctgactactgcccacaccaa
cgaggtgatctagcagatacatggcaacgtgtgaactgcaacaacgcctggtgccccagc
accaaccttccaagtgtaaaaacaatgtgctgctgcttcacttccgccctccggttatca

Exon 14 +      13170      13333   0    Initial    164    40        Poor
cagcttcgatgatgtgggtgtcctgcagaagaagctggtgcccttcctcacagagttaaa
tatgcatctggcccaggaattagagaagctgaaaggatgatcctggggaaggtggagcag
ctgcaggcctggctgcaggcctgactactgcccacaccaacgaggtgatctagcagatac
ATGGCAACGTGTGAACTGCAACAACGCCTGGTGCCCCAGCACCAACCTTCCAAGTGTAAA
AACAATGTGCTGCTGCTTCACTTCCGCCCTCCGGTTATCAAGCAAAATGTCTCTTGTGGC
CCATCTTACTGGAAGAGAGTTCCGGGAAACATAGCCTCACCAAG
gtgacacattacaaagccaccctaccatgaatccgctcccaagggtctcactgctcacct
gaggataactcaatataactatgtggctgaaaatgcaaagctgaagaccatggatttcat
ggtgattccagcaagtacagagattctatgaagcccacccagaaaaaacttgctggtcct

--------------------------------------------------------------------------------