--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (81152 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (21 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1459       1667   0    Initial    209    66    Marginal
caaacctgtctaattggggcggggagcggagcttcctcctctgagggccgtgccgcgctg
ccagatttgttcttccgcccctgcctccgcggctcggaggcgagcggaaggtgccccggg
gccgaggcccgtgacggggcgggcgggagccccggcagtccggggtcgccggcgagggcc
ATGTCGCTGTTGGGGGACCCGCTACAGGCCCTGCCGCCCTCGGCCGCCCCCACGGGGCCG
CTGCTCGCCCCTCCGGCCGGCGCGACCCTCAACCGCCTGCGGGAGCCGCTGCTGCGGAGG
CTCAGCGAGCTCCTGGATCAGGCGCCCGAGGGCCGGGGCTGGAGGAGACTGGCGGAGCTG
GCGGGGAGTCGCGGGCGCCTCCGCCTCAG
gtgagctcagggccgcggcaggccgggcgcgcgggtcgagcggggtgggctgcggtgggg
aggtgggggcgctgtcggtggggctgagcgcggcgggggccgccggcgtgagtgagcgga
ggtggggaggacttcggtcattgaggcggagcggaactcagcagctccccggaacgcctg

Exon  2 +      10985      11151   2   Internal    167    60    Marginal
gaggaattccccgtgatgaaagaggaggaaaggatactcgcattcattatgtgaatagtt
tgtcaccacccacccactcacttgtgatttattccatacagcaccaccgtggtccagata
tatagcaggtgtatcatgtggaagaaagctgttgacttgaattctttctgttgctttcag
TTGCCTAGACCTGGAGCAGTGTTCTCTTAAGGTACTGGAGCCTGAAGGAAGCCCCAGCCT
GTGTCTGCTGAAGTTAATGGGTGAAAAAGGTTGCACAGTCACAGAATTGAGTGATTTCCT
GCAGGCTATGGAACACACTGAAGTTCTTCAGCTTCTCAGCCCCCCAG
gtaggttttgttcttaggattattctccaggagttcatggagccaaacttagaagaaatt
atctcttttgaccaggtgaactgtgttaagtatttttggaaaatgtaaatgtgtagtgcc
ttgtttgctttcccaggttgaagcaaatgcaatgcatgaatattggttggattgtggttg

Exon  3 +      16709      16766   0    Initial     58    57    Marginal
atacgcattgttatgttttggctatttttattactttatctctaaaataagtgcaaaggt
tgtttaatgttattctttagtttctaaaatacctttacttcacattttatcttcacaatt
ctgtgaagcgacagaacagtgctattgtgaacatttaaattttaaccaacaaacatttac
ATGGAAAATGAGATTTCCAAAAGTGATCATTTGGCCAAAGTCACAATTATTGACAAAG
gtaggattaaaaaccaggtctgctgaccctgacctgaactcaataccatttccataatgc
taggaaatttctgaattaagaaacttagttctgtattattacctcagttgcctctttgac
ccatggacttcaatttttttcttcttgccaacttaaaaagtgctcaaagactggatctta

Exon  4 +      19634      19802   0    Initial    169    60    Marginal
agagtgaaggacactgaactgggtgaatgtaatagataactggggggtgggagggtacct
aatttagagacatttcccagagaagctggtgatattttagtaagaaacctggatgatgag
gaaagagcctgccatgaaacagtagaatagtggaagccagtggggtggcggttgcggggg
ATGGCAAAGCGGAGCTTGTGGGGAGAACCCAGCAGAGGACTGGTAAGTGGAAAGGCAGAA
AAGAGCTTGGCTTATAGAAGGAAGGAGGCCCAGTATGGCTGGAGCTTGGTGAGCCTGGAG
AAGAGCGGAGGGGCCAAAGGAGCAGTTCGTGGAGGACTTTGTAGCCATG
gtaaggaatctggattttttattctaagtacaggcacactttgttttattatgcttcact
ttattgcactttgcagatacttcactttctgcaagttgaaagcttgcggcacccatgtgt
ctagcaagtctgtcagtgccatttttccaatagcatgtgcctacttcatatctctgtgtc

Exon  5 +      20162      20413   0     Single    252    43    Marginal
cacaccttggtaactcttacaatatttcgaactttttcattatatctgtcgtggtgatct
gtgatcggtgatctttggtgttactactgtgattgttggtgcctggtaagatggtggcat
ccaggtggcggtcttaagaccagatcagtatggtgttggtggtcttaagaccagatcagt
ATGGTGTTGGCAGATCAGTATGGTGCCGCTAGGCAGGCACTGACTAGCTCCAGGCAGCTC
AACCTTGGGAGCTTCGGGGCCCCGAGAGGTGGAGCCTGTGAGTGGGGCATGCACTCCATG
TGGAAGCCAGAGCCTCCTCCCCTGGATGGAGTGTACGAGATCCCTGGACCGGAGCCCATC
CCCTCTGTGAGAGAGATGTACTTCACGCCCGGGCTGCCACCGCTGATCTTCCTGCCCTGG
GACCCTGGGTAG
aaacacccaaaattctgttcaccccgttcacgaccctgggaccctggctcgaagcaccca
aagttctgctgctcaagctccattcacgagcagccaccatacaaagaccaggcctgctat
gtctttcaccagcgttgccgccttctcaggggtgtcaagcaggccctctggcttaccgag

Exon  6 +      21012      21233   0   Internal    222    98   Excellent
aaaactccacgttatccaccacctggaattgtgtctgttcttcagggtcatggttctagt
ggagccggctgagtgccaaggatcctctgcccccgccatctcctccagagaagaggttga
agctactaaaaatcatgttctcgaggccttctgtcccctctccccactactgatcttcag
GAATGCAATGTTTCTGATGTGAAAGATGACACAGGATTCTGGGAGGGCTATCCTTACCCC
TATCTCCATATCCTGCACTTCCTGGAGAAAGCCGATTTGCAACCACATAGCCTTCAACCA
GATCAGCTGTGGGCCAAGATGATCCTGTTTGCTTTTGGCATTGCCCTGGCTCAGGCCCAG
CTCCTCTGTGGCAATGACACCAAGATCTCGGAGCAGCCCGTG
gttgtgcagagtacatgcacagacggacgtgcattccatttcctggtgttacagtagaac
accacagacctggcctcttaacaagtgtggcaagagtttggtctgggtggaatcatgcca
gctactctctcagcatttttggtgtctcccagtgataaaaaagaaggtgggaccgggccc

Exon  7 +      22694      22806   0    Initial    113    53    Marginal
ctagaattgattttacttaatgaggaaggcatatcaaaagctgagataggctgaaaagct
aggcctcttgtgccagttaaccaagttgcgaatgcagaagaaaagttcttgaaggtaatt
aaaaatgctacttcagtgaacacacgaatgataagaaagcaaaacagccttattgctgag
ATGGAGAAAGTTATAGTAGTCTGGATAGATCAAACCAGCCACAGCATGCCCCTAAGCCAA
AGCCTAATCCAGAGTGAGGCCCTAACTCGCCTCATTTCTGTGAAGACAGAGAG
gtgaggaagctgcggaagaaaagttggttcatgaggtttaaggaaataagctgtctctgt
aacataaaagtgcaaagtgaagcagcaagtactagtggagaagctgcagcaagtcatcca
gaagatctagctaatgccaggcatggtggctcgtaattgatcatggtgtctataatccca

Exon  8 +      25098      25149   0   Internal     52    50    Marginal
tttgtctgccgccatgtgagacatgcctttcaccttccaccatgattgtgagtcctccct
agccacgtagaactgtaagtctattaaacctctttcttttgtaaattgcccagtcgtggg
tatgcctttatcaggagtgtgaaacagactaatactcttaccacttgagcctctctgcag
GGCTACCTGAATGGCCTCCTGCCACAGTCATGTGCTTCCCTGGGGCGAGTGA
gtgagagagaggcaagagaaggagttgggggtgttccattattgactaggattttcttcc
aaattcctgtcaaaagtcttccaagcttagatgttggcagttattcctcaaatgaggaat
gtttgtgtcacaggtatatcaaatatatatctcactgctctgtttctgtgtctttctctt

Exon  9 +      25476      25578   1   Internal    103    72        Good
atatctcactgctctgtttctgtgtctttctcttccaaaatcattttcatttcaatacta
aataataatgcagtcatttgaagacgttttcaatggtgttgtctttgtccattgcatgct
tccataatacagtaccacagactgggtaatttttaaagaacagacatttatttctcacag
TTTTGGAGCCTGGGAAGTCCGTGATCAAAGAACCAGCTTCTGATGAAGGTTTTCTTGCTG
TGTCCTCACATGGCAAAAGAGAGAGAACCTACCTGCAAACCCC
gttattacagcggcattaattcattcgtgagggtagagcctcccgctaggccctacctcc
caacattgttacattggggattcagtttccagcacatgaatttgggggcacatattcaga
caatagcagacattgcaacttaacacgtctgttactaacagtgcacgtaacttgactgaa

Exon 10 +      30256      30406   0   Internal    151   100   Excellent
taatacttcagtcctaaataactcaaagcgttactgtttttaactcagaaatgttttaga
acttgggggaaaaatgttgcactttcaaagcttcatactgaaatcatagattttgtacag
catattttataaggtgtgtttttgatgagtcatccacttctcttattgattctttcacag
ATTCCAAATGGAAATACATCAGAGCTTATTTTTAATGCAGTGCATGTAAAAGATGCAGGC
TTTTATGTCTGTCGAGTTAATAACAATTTCACCTTTGAATTCAGCCAGTGGTCACAGCTG
GATGTTTGCGACATCCCAGAGAGCTTCCAGA
gtaagtaacgaaagaagctgaatgttgggatggggattccccatattttattttatttta
aatgtttacttttaaacaatttcaaagtatcaaaaaacatagcaaaatttcacataggta
cttcatccattataatgtcaaccattgttaagatttgatccatgtgttttgtctttcttt

Exon 11 +      39791      39894   0   Internal    104    99   Excellent
tggaatcattacaacatttacttgctggtatttaacctgatgaatggagctaatgtaaca
aatgtctaaagccttctaagatgttatgttttggagcgtatttttaaaacacaaaatgat
tttttctccaagccattaaaatagaagaggaagcatttacatgttctaatattgatatag
GTGCCTTATGTGGATTTGGAACACCAAGGAACCTACTGGTGTCATGTATATAATGATCGA
GACAGTCAAGATAGCAAGAAGGTAGAAATCATCATAGGTAAGAA
gtatttccccagtgttctgacaagtggactataatataagctatataaactgcaacgttt
aattaagcaaaggaaattatactttttaccccatactatttaatgatgtgttaagcatta
gaagttatattgtttatattgaaatttgaaagaatgcatactaaaatcataatctaggtt

Exon 12 +      44546      44585   2   Terminal     40    93   Excellent
atatctggagtaagaagtgtgtttgtggggatcattggcatcgtacaggtcggttggtca
gtgaccatttcttaatgagtgacagttgtcaagagtatgtagaactctgtaggctaattt
taattagaacagatttctaataagttaagccttcacctgagataaaaggcatatcaacag
TGAGAACTACATGAAGACACAGGATATCAACCTCGTGTAG
gctttctgaaagacaatgatggaacctgtggatagatctgaaaataaaacctttcaggaa
tagtttaagaaggtggttatgtcatttaatatttgtagaaaaccctattacttctccact
tatttctcattattttagcatcattactagtttgcttagtgtcatactcatattgcatta

Exon 13 +      52895      53066   0    Initial    172    92   Excellent
agttctaaaatgaaattaaataatgaaatcttatttgaaatgaaataatgcaatcttaaa
gcatactttttattataataccatctccataggttttgttttaatctttatatcttcttt
aaacaccccctttctttttttttcaaagcgaaggacaaggttgcccttttgataggaaat
ATGAATTACCGGGAGCACCCCAAGCTCAAAGCTCCTTTGGTGGATGTGTACGAATTGACT
AACTTACTGAGACAGCTGGACTTCAAAGTGGTTTCACTGTTGGATCTTACTGAATATGAG
ATGCGTAATGCTGTGGATGAGTTTTTACTCCTTTTAGACAAGGGAGTATATG
gtaagatatttataatgtttgtttttacaattatccattattcttttcattatacaagtt
aggttaagaattgaaaatcagataaagataaggtaaacatgttgttgaatggaagagttt
tatttttcttattaagatgatacatttgatcttcattccatctgaataactaattagctt

Exon 14 +      63230      63389   1   Internal    160    90   Excellent
aataacattgtctatatttataattgggtatttcttacatatgctcacatcaacctgaag
aaaattaaagtcaaggtttttctacaaaaagttatgcagtctgtatgttcagagtgcatt
tagaattgacatctatctctctcttatttttcctcttttcagggttattatattatgcag
GACATGGTTATGAAAATTTTGGGAACAGCTTCATGGTCCCCGTTGATGCTCCAAATCCAT
ATAGGTCTGAAAATTGTCTGTGTGTACAAAATATACTGAAATTGATGCAAGAAAAAGAAA
CTGGACTTAATGTGTTCTTATTGGATATGTGTAGGAAAAG
gtaagttttctaatctttattaaagaattgttggagttaaatatcgaccatgacaaacta
gagaaacctgtgaaatgctaaaagccatttgcgtttgtgaattttagtttatacattgaa
actggaagaacaaaactagaggaaaatacatttactccatgtatatctaattattttaac

Exon 15 +      64122      64200   2   Terminal     79    99   Excellent
caaggagttagtgggttattttgggtagatatgtagctacctagatgaaaaattttgaat
ctataattttaaattatgtattctaaaaaactgttgtattttctcattatttataccctt
ttaagaatgctctttaacttttcatatttctatctgccctcctccgcctcccttaaatag
AAATGACTACGATGATACCATTCCAATCTTGGATGCACTAAAAGTCACCGCCAATATTGT
GTTTGGATATGCCACGTAA
gaacatttgatgtttacgttgaagtttcctttattgtttgatgtctttttgtttttgctt
tttaggagcaggggtcttaactctgtcacccaggctggagtgcagaggcgccatcatagc
tcactgctcctgggctcaagcgatcctcctgcctcagccttctgagtcgctgggattaca

Exon 16 +      71682      71829   0    Initial    148   100   Excellent
gtaaaaattaaaacatgcctgatatgtctggcacataataggtgctcaggaaatatttgt
tgagtgaataaatgatactgagaatataacctgataatgtaggatagttcttagcctaaa
tatttaaaacataagaattggtggtcttaaaaataatatttattttcatatcttttagat
ATGGGTAAGTGTCACCTTACCAAAGGCAAACAGGCTCTAGAGATTCGAAGTAGTTTATCT
GAGAAGAGAGCACTTACTGATCCAATACAGGGAACAGAATATTCTGCTGAATCTCTTGTG
CGGAATCTACAGTGGGCCAAGGCTCATG
gtacggtaaagcccattttttgttagatctacaatatacttaacgttaaatcataaagtt
tcttctgaataaataactttcctcccagttttacagtgaaaatattttggcctactaggc
aaatctcaaaccaaacaaatatttcaattatggatattacactggcttatttgatttaga

Exon 17 +      72128      72213   0   Internal     86    53    Marginal
gcaaatctcaaaccaaacaaatatttcaattatggatattacactggcttatttgattta
gaaatatcaaattatttagcccattattgtcactattggtaaaatttaaatgaccattta
aaaatttttctatttttaaaataggttaagtttccatttgtctaatacacaatcctttag
ATTCTCCTATATTGTGACCTGTCGAAAATCATGGATTGGGTTCTGATCCAGTCTCTACCA
CTCTATGAACATGTTATCTATAACAT
gtaaataagaaatggtacctgcttcaggctgggtgtggtcgctcacgcctgtaatcctag
cactttgggaggccaaggcaggtggatcacctgaggtcaggagttagacaccagcctgga
caacatggcaaaacctcgtctctactaaaaatacaaaaagttagcggggtgtggtggcac

Exon 18 +      74153      74310   1   Internal    158   100   Excellent
gtaaatgaaagactttgtttggccagcagaatagtgagcattattttttaaattgtatgt
gtttaaacaatgtaaatcatgtttttaagcaaaagaaatgctaactatattctcctccat
aaatatttgcctcttatcatcagaaaacctaccaaagttgttcttattgttctttttcag
AACTTCCAGAAAGTATGTGTCTTAAGTTTGACTGTGGTGTTCAGATTCAATTAGGATTTG
CAGCTGAGTTTTCCAATGTCATGATCATCTATACAAGTATAGTTTACAAACCACCGGAGA
TAATAATGTGTGATGCCTACGTTACTGATTTTCCACTT
gtgagtctcttcttttatttaaaatacagtgatatattctcacttattaaagactaaatt
ttttaaaacttaaagttgatggtaaatataaaggaaatatatatatttatatatgtgtat
atatttatagtttagtaacactgatcataatatttactaattgccaaaataccttaagtt

Exon 19 +      75481      75606   0   Internal    126    84        Good
tattataaccatagattgttgttttcattgtttagtcctggataattttgggattaccaa
aattcacgagaggccagaattcacgagaggatagtatcagttaagatgtcttatgtacta
gattatattgtggctttcattgatttcattattaacagtccctaatttttttttttacag
GATCTAGATATTGATCCAAAAGATGCAAATAAAGGCACACCTGAAGAAACTGGCAGCTAC
TTGGTATCAAAGGATCTTCCCAAGCATTGCCTCTATACCAGACTCAGTTCACTGCAAAAA
TTAAAG
gttactaccttttctgtttatagctactaatggaaaactttatgaaactggaaacttatt
ttggcatagaccatagatatgctgccttattattaaagtagagataaccagtctacagaa
ggtcctatcagtgaccctttttatattctgtttccgatggtgaccagaggactttatgtg

Exon 20 +      77006      77115   0    Initial    110    77        Good
agccaccacgccgggcccagatcattttttaattaaaagttaataccccatctctaataa
tagggaagggtaagtttcctaagctgcactgcttggaaaatgttttccctgttcatctag
agtgtaagaaagatctctttgactttgactactaacagtagtaagaactagaaattctaa
ATGGGTTGTAAGTATTGCATGAAGGAAAAGGAAGATAATGATAGCTGGCGTTTCTCAGTT
TCAGGGAGATATAAAGGATGCCTTGAGGATTTGGAACCTGGGAAAGGAGA
gtgagtggatttttgggggtgggggtgtgtatgtgtgaatattttcagattgatatatat
tcactgttgatgccaataataaaccagatttttttccttttcaggaacatctagtcttca
cagtatgtttatcatatcagtactcaggattggaagatactgtagaggacaagcaggaag

Exon 21 +      77220      77340   0   Internal    121    90   Excellent
ataatgatagctggcgtttctcagtttcagggagatataaaggatgccttgaggatttgg
aacctgggaaaggagagtgagtggatttttgggggtgggggtgtgtatgtgtgaatattt
tcagattgatatatattcactgttgatgccaataataaaccagatttttttccttttcag
GAACATCTAGTCTTCACAGTATGTTTATCATATCAGTACTCAGGATTGGAAGATACTGTA
GAGGACAAGCAGGAAGTGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGCATCGA
G
gtttgggaaggaagacttgctttcaaacttgtcttatgtctaatggtccttaccagagtt
ctgcagccacctcaggaggagcagggcattatcactcattgcaagacccattccatggtg
tttaccattcacatcctggtaatccaagtaatgttacaccagcagatagctgtcattgca

--------------------------------------------------------------------------------