--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8067 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1202       1311   0    Initial    110    74        Good
tctaactatagcaagcaagaagtggcagggcgcgcaccggctgtcgccaagtgctgttca
actcagggagccggggcttcgctccgtccctcccccggcttccagagctttttggggttg
gagggtgggaggccaggggcgttctcacagctgtgtgtcctctttcccatcctgcgcaga
ATGACCATGTGTAGCGGAGCGAGGCTGGCCCTGCTGGTCTATGGGATAATCATGCACAGC
AGCGTCTACAGCTCACCTGCCGCCGCCGGACTCCGGTTCCCCGGGATCAG
gtaggtgctggctgcctggcccaagcaggagctggggcttcccaggcacagacgcttcct
cacggtctccttcctgcagtcctttgggtccagactactagcatcgccctctgcgccccc
ggtgcgcctccgccagcctcggctggacagcgggtccccattctagccgagggtctggca

Exon  2 +       3474       3605   2   Internal    132    96   Excellent
ttgggtgtcgttgcctcctccttacctctgctcccacccccagtcctgggagaagagaca
attctcagcggaggacttttatcacctgtgaaaatccgcgcgagccccttactttggatc
ctcgccgagctggggaggaacttgcactgaccacaccttctgtccccggccaccccgcag
GCCAGAGGAAGAGGCGTACGGCGAGGACGGAAACCCGCTGCCAGACTTCGATGGCTCGGA
GCCGCCGGGCGCAGGGAGCCCCGCCTCCGCGCCGCGCGCCGCCGCCGCCTGGTACCGCCC
GGCCGGGAGAAG
gtgagattcgcgcggcctcgcgcacacccgcggctgggagctcgggactgcggtgacggg
aggggcagtgtggtgacccacccaggatttttttttttttcccgtgaaagtcctcaagcc
tgtcctctccctggcccgatcctattgcagcgacagaaaatcagcagcgggcgggtctgt

Exon  3 +       4080       4178   2   Internal     99    97   Excellent
ccgatcctagcagttgctctcgagatcatcccgggagttattggcgagttctgggcctct
ggaggtttccctgtcagcctccccggccgccgagggggcgcgcgcccaacaagggggtct
ctagcggccacctggggacagaaacagtgaccctgggcgcgcactttgcctccccgttag
AGATGTCGCCCACGGGATCCTTAACGAGGCCTACCGCAAAGTGCTGGACCAGCTGTCCGC
CGGGAAGCACCTGCAGTCGCTCGTGGCCCGGGGCGTGGG
gtaagagtttgtggaaggattaacctgcgcgcgccggggtgggtgcctgtgcggggcgcg
cggggcgggcggcggtgggtgcccgtgggggccagggtgagtctgcgcccctgggtctgg
ggtgggcatccgccacgggtcgcagttggagattttgaagtggcactttaaatttgccca

Exon  4 +       5261       5450   2   Terminal    190   100   Excellent
ggctgccgtctcggccctccccacggctgcttccaggcagaggcgggcgacgcggtgggc
agtgcgagccccgggccctccccgaaggctcccgcgtggggtggggcccgcctgctcccc
gcggcgattgaacctgtgtctcccgccccgccaccctcttcccgacccctttgcttgcag
TGGGAGCCTCGGCGGCGGCGCGGGGGACGACGCGGAGCCGCTCTCCAAGCGCCACTCGGA
CGGGATCTTCACGGACAGCTACAGCCGCTACCGGAAACAAATGGCTGTCAAGAAATACTT
GGCGGCCGTCCTAGGGAAGAGGTATAAACAAAGGGTTAAAAACAAAGGACGCCGAATAGC
TTATTTGTAG
cgatgggttaccagctaccctgtgtatacagccctgacgcaatgaaaagtcgttttccaa
actgactcaacagtcatcgctcgtgtgttctatccaaacatgtatttatgtaatgaagta
aagccattaaatgaatattttgataataatattgtttttctttctacaaagcactagaga

--------------------------------------------------------------------------------