--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (32427 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      11880      12046   1   Internal    167   100   Excellent
aaactggtagtccttaagactctgcttccatgggtatgacttgttctaggtattattgcc
taacagaaatttccattatctaattttaaattgtgtaaggtttcacagtgagattattcg
aagcatttagaggtatttactaacctgtgatggcttacaaatctcttcttgttgcaatag
GTGTGTTTGTAGTTGCTGCTAAGCGAACGCCCTTTGGAGCTTACGGAGGCCTTCTGAAAG
ACTTCACTGCTACTGACTTGTCTGAATTTGCTGCCAAGGCTGCCTTGTCTGCTGGCAAAG
TCTCACCTGAAACAGTTGACAGTGTGATTATGGGCAATGTCCTGCAG
gttagtagagtaaaggaaggtgttcactcctattgcttctttgatcagtttctaaaaata
attcctttaacatatcataatggtaaacaagttaataatagttatagacttttttttttt
ttttttgagatggagtctcgctctgccgccaggctggagtatggtggtgcgatcttggct

Exon  2 +      18852      18989   0   Terminal    138    92   Excellent
tggtaatggatactttagcatttgctttacagttactttaaaagcatttccttttgagac
actgtaagctacagtacaatatttgtttgatttaccattaatttgtaaaatcagtgtgtt
tcttaatacattgtttgggtacggtaaaaggagtttttattactgtttgtttttaaatag
GAAATTTGTGTTAAAGAAGCTGAAGTTGTTTTATGTGGAGGAACCGAAAGCATGAGCCAA
GCTCCCTACTGTGTCAGAAATGTGCGTTTTGGAACCAAGCTTGGATCAGATATCAAGGTT
GGAACCATAAAAATTTAA
aagaattagttcttattagcattatataagtacttttaataacatacctttttatgggag
agaaaactaattttgaagccaatttcgttgatgaggattggcaagatatgaatgattaga
agtttgtaaactatttcaaaactctattttggtggttagttttgacattttaacccatat

Exon  3 +      20363      20453   0    Initial     91    85        Good
gttatcagaaagtcttaattttacttttgtttattggaagtgttgattatttaaagaaat
tataacatattacttttaaaaggaaatgccttaacaagtcactttattaatgtcttttaa
tagctggaagattctttatgggtatcattaacagatcagcatgtccagctccccatggca
ATGACTGCAGAGAATCTTGCTGTAAAACACAAAATAAGCAGAGAAGAATGTGACAAATAT
GCCCTGCAGTCACAGCAGAGATGGAAAGCTG
gtgagtgaaactggaaagtatcagtatctatagaataaatatctataggaaatattttca
tcatttctattatggttatataatatttacaaatcatacctttaagaattattacatctt
ttcattattcctttgtctttagatgatcagatattttattaattattgcaaaattaacta

Exon  4 +      22406      22585   1   Internal    180   100   Excellent
gtgccgttgcactccagcccaggcgacaatgtgagactccatctcaaaaattaataaaga
ctcaatattaaagtagactgtgaggaaaaggtagatcagaaattaaattgaataatatgt
ttgatttattttcatgtttctctcttttattcttatgatagtctctctactatttttcag
CTAATGATGCTGGCTACTTTAATGATGAAATGGCACCAATTGAAGTGAAGACAAAGAAAG
GAAAACAGACAATGCAGGTAGACGAGCATGCTCGGCCCCAAACCACCCTGGAACAGTTAC
AGAAACTTCCTCCAGTATTCAAGAAAGATGGAACTGTTACTGCAGGGAATGCATCGGTTG

gtatcaccacacagattagcttgaattcttcctggtgtgttcaacaaaagtaatcatgaa
gtatcttgtaaatactttttatgccagtctttagttgtttagcttaaactaatagtgttc
atattcaattaatttaggttttcatagacccacacaaaatcttttcatatttatttatat

Exon  5 +      23141      23263   1   Internal    123    92   Excellent
tgccttaaaaaatctccttcatccaccacagtaccacttttctaattgtatctcacactg
tgcactggcttcctatgtactgccatattcctaatactactagtccattagttcaaactt
tgattaactggattattttagcctttagttaatctagtatttttattttcaagggtgtag
CTGATGGTGCTGGAGCTGTTATCATAGCTAGTGAAGATGCTGTTAAGAAACATAACTTCA
CACCACTGGCAAGAATTGTGGGCTACTTTGTATCTGGATGTGATCCCTCTATCATGGGTA
TTG
gtaagtttatagtaaaacaaactggttctataatatttctggaggtaagtcttctttggc
attcagagtcctgaaaaagtggccaaaccaaggtcacctgtagagaaaagaagattggta
atcagtttaaataaaaaatctttatgaagaactgtcctagacacaatagaaaaaccaaga

Exon  6 +      23645      23752   0     Single    108    46    Marginal
agtaatcatatcttagtgtccatttgagatttaaaaaatcaacacacagtaattatatct
tattgttcctttgagagtttagaaatcaacacagaaaataacagaagaattacgtgatcc
tgacaagataaaagaaattatgagatgggagaaatcctggggtgaaacagagaaggctgt
ATGGAGAAGGTGGTATCGCAGCTCCTTGCTGGTTGTTTTACACACATTCAGTCTTCCCAC
GTCTCCAGTAAGGGAGACTTCTTTGTGAATGAGAAAATTGAGGCTTAG
ggaggttgtcttacaaggttccaaatcagtaagtgacagccagggtgtgaatccaagtct
ctctgaaatcaagtgctctcttcactgtgagttaaacgcatagtctcaggaagtcaaatt
aatattcctcttgctcaggtgagtattagcaaaataaagacttataattagattggtaaa

Exon  7 +      27372      27442   1   Internal     71   100   Excellent
ctttttctgcctctttatggtcacttcatttaataggtacggtcaaggtagtaagatttg
tggctactaataactgccgcattatttcttccttacttggaaagaaggagaagcttgata
cgtaaatataagatgacatttatttctatatttttatagaagatttttattattatatag
GTCCTGTCCCTGCTATCAGTGGGGCACTGAAGAAAGCAGGACTGAGTCTTAAGGACATGG
ATTTGGTAGAG
gtaagtgtttttttttttttttttttttttaacaacatgaataaaccatgtacttttata
gcataaatgactttaatttggtctcattgctctttgaatttcattgtagttagcctttcc
aaatgatgtacatctaaataaatagtaccttcattagatgccttgtgttgatacttttcc

Exon  8 +      30771      31052   0   Terminal    282    90   Excellent
tttgttctttgttttttgttttttttgattaaaaactttcagctttccaaagtctgttgc
ctgttgtaattataccaaaattgaggactggggaaaagattgagcagatgagctgaataa
ggatgagtaatgcagatgtgatgttattagttctatttcattaatctgattttttattag
AGTAGATTTCAGTCACTGCTTTCTTTTTCAGGCGTCGAGGTGGAAAATATGCCGTTGGAT
CAGCTTGCATTGGAGGTGGCCAAGGTATTGCTGTCATCATTCAGAGCACAGCCTGAAGAG
ACCAGTGAGCTCACTGTGACCCATCCTTACTCTACTTGGCCAGGCCACAGTAAAACAAGT
GACCTTCAGAGCAGCTGCCACAACTGGCCATGCCCTGCCATTGAAACAGTGATTAAGTTT
GATCAAGCCATGGTGACACAAAAATGCATTGATCATGAATAG
gagcccatgctagaagtacattctctcagatttgaaccagtgaaatatgatgtatttctg
agctaaaactcaactatagaagacattaaaagaaatcgtattcttgccaagtaaccacca
cttctgccttagataatatgattataaggaaatcaaataaatgttgccttaacttcagtt

--------------------------------------------------------------------------------