Gene YWHAE Variant 1
DNA : 55.64 KbNT_010718
mRNA : 1743 bp NM_006761
CDS : 768 bp NP_006752
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  143 bp
cccgctgagccgacagaggagaggcgtctcgtgcgctcgttccagccgcttcgggcgccg
agttccaggacccgccccccgcgccagttgccagggagcggttgccatagagctgagcag
ttgtccgcgtgcgcaggcggaagtcccggattgaggcgccgccatttttgctgcccggac
GCGGAGCGAGAGGCTGAGAGAGTCGGAGACACTATCCGCTTCCATCCGTCGCGCAGACCC
TGCCGGAGCCGCTGCCGCTATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGC
CGAGCAGGCTGAGCGATACGACG
gtgagttgggggggcaacggggggctggaattctcggaccctctgccgccgcccacagag
gccgggaacaggagacaaaatggcggcatcgtctgcgagcctggcccgggggcttgggtt
cgggaagcaggaaatggcctgggagctcccggggcgatgggaggctctatgccctggaat
EXON 2  200 bp
cttagtttggtttcctttacatgtttttggctttttactcatattagttttgatgattat
gaaattatttttgttaaaatgtttttttcgcagtagcttgacagaaaaaaactactttga
aaggaatatgttaagaaaacttcaaatttgtaaggtctgacttttccttttcccatacag
AAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAAGAAA
GAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGGAGAA
TAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAAATGA
TTCGGGAATATCGGCAAATG
gtgagattgttgtgccatcatccccccttatccacagtttgagttacctgtaggacggta
cacttaagattttgagagaaaaggagactacattcatataacttgtattacagtatgtta
taatgtttctgatattgatctttgtgcctggtttataagttaaacttacccgtggctatg
EXON 3  107 bp
tttataacctagaggcagcttttctctgcttttgtgtcaagaaggaagaagggagtttgg
agagggatacaaattctttttaatactaagctctctacctcaaaaccagagatagaatat
gtaataatttgtagaatttctagacttaatctgatttaaaaaaaatttttttttttttag
GTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATTCTGGATGTACTGGACAAACACCTC
ATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTCTATTATAAAAT
gtaggttctatactagaagggaaaatgtaagattgaaagttggtccttttagaaccataa
ctttgttctatgtaggttttcaacttttatttaagaataattgttcaatgttagaaggat
agttaatattgtaatgaaaaggtggttgggctattatgaaaatgtattagcttttgctta
EXON 4  207 bp
gaaaaaaatgaaacgaagccagttattcctgagagtgtttaaaattattgaagtacacct
aattgttacatatatttttgtcacattttatataatatagaacaattttagcttattttc
ctttaaaaatcgttcctagtttaaattttttttttttttttaattttggttttgttttag
GAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGACAGGAAGGAGGC
TGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATGACAGAACTTCC
ACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTCTACTACGAAAT
TCTTAATTCCCCTGACCGTGCCTGCAG
gtaagttgtggggaagaacagcagcgctcagcgtgaaagttaaggggggcgctgtttggg
ttttccgtgttgtttcttgggcctgtctttgtagacttggctgcatagtaattcttttgg
ctcttactgaaactactttggatagtattaaaacagacctgtctcaacccactagcatag
EXON 5  137 bp
gtaagaagtagtgttccacatacctttaagttaatttttattgtatttgctttttctttg
cattatcattgtgactattacaaactggaataactgaagaaaagattgctgtctagcatg
tcatttctaattctgattttggacttaatttttataacacttctattgaaatacctttag
GTTGGCAAAAGCAGCTTTTGATGATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAG
CTATAAGGACTCTACACTTATCATGCAGTTGTTACGTGATAATCTGACACTATGGACTTC
AGACATGCAGGGTGACG
gtaagcaagcacggagtgaaacaggcacctctttcagttgcaggatttgtttgtactctc
tttagacattccttggcttgtcgttatatcaagctagaatttagattcaccgcctgccct
ctatgaaattgtaattgctgcctttataggaaatggtgctacagtacggagttccatttt
EXON 6  949 bp
ataatcccttcttggcttaggcatctcaggtgtcaaggatgatagaagtcctttgcctgc
gtttaataccaattgtagcaagtagaagagtctttatgcttggaatgacacctttgtttg
tggctgccatagcctaatgtagtcaatacgaaataattgactttttttcttttttaacag
GTGAAGAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGAGACATAA
GCCAACAAGAGAAACCATCTCTGACCACCCCCTCCTCCCCATCCCACCCTTTGGAAACTC
CCCATTGTCACTGAGAACCACCAAATCTGACTTTTACATTTGGTCTCAGAATTTAGGTTC
CTGCCCTGTTGGTTTTTTTTTTTTTTTTTTAAACAGTTTTCAAAAGTTCTTAAAGGCAAG
AGTGAATTTCTGTGGATTTTACTGGTCCCAGCTTTTAGGTTCTTTAAGACACTAACAGGA
CTACATAGAGGCTTTTTCAGCATTACTGTGTCGTCTCCGTGCCAGATGTGGCAAGATCAC
CATTAGCAAATGGAAATTACATTTGAAAGCCATTAGACTTATAGGTGATGCAAGCATCTA
AGAGAGAGGTTAATCACACTATAGAGGCATAAGTGGTATCAGTTTTCATTTTTCTAATTG
TTTAAACTGTGTTTTATACCAGTGTTTGCAAGTAATTGGGTGTTAGCTTGAGATGGTTAA
AGGTGGTTTGGGGAGGGACTTCGTTGTAATGGTTTTGCTGTAAAAAATGTTTCCAACTCC
GCTGAAATGTTGCTGAAAAGCATGGTGCTGGTAACAGTTCAACAATCCGTGGCTGCTCAT
TCTTGCCTACTTTACTCTCCCACTGAAGCAGGTTAGCGTTGAAGGTGGTATGGAAAAGCC
TGCATGCCTGTTCAATTCTTTTGTTTCTTCTCCTTCCCCCTCCCCCTACCTCCTTCCCCT
CACTCCTCCCCTCCTTCGCTCGCTCAACCTCTTTTGTTCAGTATGTGTAACTTGAAGCTA
ATTTGTACTACTGGATATCTGACTGGAGCCACAGATACAGAATCTGTATTGTTCTTACTG
AAACACAGCATGGAATTAACATTAAACTTAAATAAAACAAACCTAAATT
aaaaatgccaaatatcgcgcctccatcctttatacttctaaaataaaatctctagtccaa
acacactgacagtattatgtttgcctgaatgtgaaacattcctccttttttcttccataa
ataatttgtttgcttcccaaagatgtatgttttggaaaaaaattgcctgtagtctggttg