Gene XYLT2 Variant 1
DNA : 15.12 KbNT_010783
mRNA : 3567 bp NM_022167
CDS : 2598 bp NP_071450
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  244 bp
gcacacgtgggagccaggggcaccggcggagacacgagcgcagaaggcacgcgctcaagc
ccacgcccgcgactgccgggactgaaggtgttgcgagccccggctccacccctagcctgc
ggtgcgccgtgctttggccccgcaggccccgcccccggccccgccccggcgcgcgcccgg
CCCGCCTCCCTAGGCGTGGAGGAGGGGGGGCGGCTCAGCCCCGCGCCCGTGCGCGCGCTC
GCGGCCGGGTTGCAGGGCTGGGCGCGCGCCCCGCGTCCCGGGCAGGAAGATGGTGGCGAG
CGCGCGAGTGCAGAAGCTGGTGCGGCGCTACAAGCTGGCGATTGCCACGGCGCTGGCCAT
CCTGCTGCTGCAGGGCCTGGTAGTGTGGAGCTTCAGCGGCCTGGAGGAGGACGAGGCGGG
CGAG
gtgctccgacggccgggcgggcgggcaggccgggcgcgggggcgcgcggggtcctggcgg
ggctgcgggcggccccagccggggaagtggggcacgggccgcgtgcgtgcgtgcggggcg
ccggcggtcgcccagagcggagcatccggcccccggcactcccttccccagcaggcctag
EXON 2  493 bp
gccagggaggtgctcccatggtggtactgattgtgcggagtccttaggtgaaaagcgctt
ctctgggtaaaaggtgggcaggaacatctaggtctgagggtgcccccaaccaagatggaa
ctcaaggaacaggaggaggtgagggtctgccccagtgatgtgtctgcatctctcttacag
AAAGGAAGGCAGAGGAAGCCACGGCCACTGGACCCTGGCGAGGGTTCCAAGGACACAGAC
AGTTCAGCAGGGCGACGGGGCAGCACAGGCAGAAGGCATGGGCGCTGGCGGGGCCGTGCT
GAGAGCCCAGGAGTGCCCGTGGCCAAGGTGGTACGGGCAGTAACCAGCCGGCAGAGAGCC
AGCCGGCGGGTCCCACCTGCCCCACCCCCGGAAGCCCCAGGCCGCCAGAACCTGAGTGGG
GCAGCAGCTGGGGAGGCGCTGGTAGGGGCAGCTGGCTTCCCACCACACGGAGATACAGGG
AGCGTGGAGGGCGCCCCCCAGCCCACGGACAATGGCTTCACCCCCAAGTGCGAGATCGTG
GGCAAGGACGCACTGTCTGCACTGGCCCGGGCCAGCACCAAGCAGTGCCAGCAGGAGATC
GCCAATGTGGTGTGCCTGCACCAGGCTGGGAGCCTCATGCCCAAGGCTGTGCCCCGGCAC
TGTCAGCTGACTG
gtgagggacaggggtgctccagcccttcccaggcgggggcaggggggtggcatggcccgg
atcctcacccctatctctctgaggaagaaagagccaaggggatcctacctccctgcctaa
gtcttcatccagtgtacttactaagtggcagaggcagagtggggacccacgagcatggag
EXON 3  176 bp
tacctccctgcctaagtcttcatccagtgtacttactaagtggcagaggcagagtgggga
cccacgagcatggagctccaagtctaggtttcttcggaaggcaggcagctccctcttccc
atctcacccccaccctgtgacctagggtgggcctcgccaacgcctgtcctctgctctcag
GGAAGATGAGCCCCGGCATCCAGTGGGATGAGAGCCAAGCCCAGCAGCCCATGGATGGCC
CCCCGGTGCGAATCGCCTACATGCTGGTGGTTCACGGCCGCGCCATCCGCCAGCTGAAGC
GTCTCCTCAAGGCCGTTTATCACGAGCAGCACTTCTTTTACATCCATGTGGACAAG
gtactgtggtggggagaggccaaggggtctgggatgagcagagcagaaacagaaggttgc
agacagacagagtctctgacctggcccaggtagcctaggagggaaactgaggccctgaac
aggggagtggcagcacgagccagctcagccgcttaggggctggagccctgccctgtgctt
EXON 4  203 bp
tagcctaggagggaaactgaggccctgaacaggggagtggcagcacgagccagctcagcc
gcttaggggctggagccctgccctgtgctttcctcgtcttgtgtcccttcactctgtcct
ggggtgggattggggatggcgataacactggaggctagctgagtgtctcctccccaccag
CGTTCCGACTACCTGCACCGGGAGGTGGTGGAGCTGGCCCAGGGCTATGATAACGTGCGG
GTGACGCCCTGGCGCATGGTTACCATCTGGGGCGGGGCCAGCCTCCTGAGGATGTACCTG
CGGAGCATGCGGGACCTGCTAGAGGTGCCTGGCTGGGCCTGGGACTTCTTCATCAACCTC
AGTGCCACTGACTATCCAACCAG
gtgtggggatggggctctgagtcctctgcatgggaggggacccctgtctgggcacctggg
gttggagggctttggtggaccttctctgccccataagcgtaactctgggatccgccctgc
tcagacatgggcccctgggccccagctatgttttaggggaggggttggtgtaagatgatc
EXON 5  81 bp
aggaaggatggggtggtcttcctcaggggcctctggtgctcaccaccccagacatcagcc
aggggtagggcacatggccagccagcaatcaggcagagaagaaaagccagaaggtccgct
ctgggccagtgactgagcaactatctcatgtggctgcctgtcaccccattccttcaccag
GACCAATGAGGAGCTGGTGGCATTCCTATCCAAGAACCGGGACAAGAATTTCCTCAAGTC
ACATGGCCGGGACAACTCCAG
gtgagggggtggggaaggaggccctggccccagagtcttgtcccaacccctcccacacag
ttgggctcggtggctccagccctgggtttcaaagcctccacaccagtcacaggttgagga
gtgttggttgccaggcgggtgaaagagcttagaccccaccctgcaggatccccagccatg
EXON 6  217 bp
ggccctggccccagagtcttgtcccaacccctcccacacagttgggctcggtggctccag
ccctgggtttcaaagcctccacaccagtcacaggttgaggagtgttggttgccaggcggg
tgaaagagcttagaccccaccctgcaggatccccagccatggcctctctgctgcccacag
GTTCATCAAGAAACAGGGCCTGGACCGGCTCTTCCATGAGTGCGACTCACACATGTGGCG
CCTGGGCGAGCGGCAGATCCCAGCAGGCATTGTGGTGGATGGCGGTTCTGACTGGTTCGT
GCTGACACGCAGCTTTGTGGAGTATGTGGTGTACACAGATGACCCGCTTGTGGCCCAGCT
GCGCCAGTTCTACACATACACACTGCTCCCAGCCGAG
gtgggtagcccagcaggcatgaaggccagggagggcgtgggttgggctgcctgcagctca
ccttccactctcccttgctgcttgcagtccttcttccacacggtgctggagaacagcctg
gcctgtgagaccctcgtggacaacaacctgcgggtcaccaactggaaccgcaagctgggc
EXON 7  177 bp
acacgcagctttgtggagtatgtggtgtacacagatgacccgcttgtggcccagctgcgc
cagttctacacatacacactgctcccagccgaggtgggtagcccagcaggcatgaaggcc
agggagggcgtgggttgggctgcctgcagctcaccttccactctcccttgctgcttgcag
TCCTTCTTCCACACGGTGCTGGAGAACAGCCTGGCCTGTGAGACCCTCGTGGACAACAAC
CTGCGGGTCACCAACTGGAACCGCAAGCTGGGCTGCAAGTGCCAGTACAAGCACATTGTG
GACTGGTGTGGCTGCTCCCCCAACGACTTCAAGCCACAGGACTTCCTCCGGCTGCAG
gtgcttgcccgaggccccaaggcccctggctaggtcttctcccctggcttttcaccagga
aaatggcagggtgggccagtaagagaatctggggggccacggcctgcagcaaccctcagg
ggtctggggctacaacagcagcaggaaaagccgcaggaggctgagctctaggcagtgctg
EXON 8  263 bp
ggtgggccagtaagagaatctggggggccacggcctgcagcaaccctcaggggtctgggg
ctacaacagcagcaggaaaagccgcaggaggctgagctctaggcagtgctgaggggccag
ccccaccatgccctctggggcttccagagcccttcaccctccttgcctctcccactccag
CAAGTCTCCAGACCCACCTTCTTCGCCCGGAAGTTCGAGTCGACTGTGAACCAGGAGGTG
CTGGAAATCCTGGACTTCCACCTGTATGGCAGCTACCCCCCCGGCACGCCAGCCCTCAAG
GCCTACTGGGAGAACACCTACGACGCGGCTGATGGCCCCAGTGGGCTCAGTGATGTCATG
CTCACTGCTTACACAGCCTTCGCCCGCCTCAGCCTGCACCATGCCGCCACTGCTGCACCC
CCAATGGGCACCCCACTCTGCAG
gtgagacccccttctgacatacagcaggcccttggggtgtggtgccctagggggaggcca
accagagagtgacgtcccctgcccacaacaaggccccagtctgaagcagggaaaaatgca
aataccgaaaagacggctagagccaggcatgcaggtgctgtgggggtgagatctggggaa
EXON 9  196 bp
aagcagggaaaaatgcaaataccgaaaagacggctagagccaggcatgcaggtgctgtgg
gggtgagatctggggaaaggaagtgcctggggatgggactccccagagccccctccctgg
gactccaggccaagtcaggtgtgctgatggcatctccctttctccctgctggcaccttag
GTTTGAGCCCAGGGGCTTGCCGTCCAGCGTGCACCTGTATTTCTATGACGACCATTTCCA
GGGCTACCTGGTGACGCAGGCGGTGCAGCCCTCAGCCCAGGGGCCGGCAGAGACGCTTGA
GATGTGGCTGATGCCCCAAGGGTCGCTGAAGCTGTTGGGGCGCAGTGACCAGGCCAGCCG
GCTCCAGAGTCTGGAG
gtgggacaggtcccccacttgctttctcccaacccccacccagacttggggtagtgggaa
gagagggacagacaccaagggaggggtaaggttatttttcccagtcatggcagccatggt
gatgcccccatgcagacatcctgtgtcaccccccagcctgtgcacactgaggagcacctc
EXON 10  334 bp
tctcagagctgggagagatattaaaggtctcctagtctgaccccttcattttgcagatgg
ggaaactgaggcccagaaagagacagtgactggcctgagattacacagtgagaggcagct
tcagaggagggagaaggacctttcccccacactcctgcccagctgcctctctctctacag
GTTGGCACTGATTGGGACCCCAAAGAGCGTCTTTTCCGGAACTTTGGGGGGTTACTGGGG
CCGCTGGACGAGCCTGTGGCCGTGCAGCGCTGGGCCCGGGGCCCCAACCTCACAGCCACA
GTGGTCTGGATCGACCCAACCTATGTGGTGGCCACATCTTATGACATCACAGTAGATACG
GAGACTGAGGTCACGCAATACAAGCCCCCACTGAGCCGGCCCCTGCGGCCAGGGCCCTGG
ACTGTTCGACTCCTTCAGTTCTGGGAACCGCTGGGTGAGACCCGCTTCCTTGTGCTGCCC
TTGACCTTCAACCGCAAACTACCTCTCAGGAAAG
gtaagcgtgcagttctcaaatgaggcccagaagccagacagaataggactcgccagagag
gtgacctcaagaagccaaccatcagagctgactcccatccctagagtcagggaagcatgg
aagggctggggccttcatcttctttcctgtagcatgcagggtcctgcactgcagtgtggt
EXON 11  1183 bp
ttataaaactcagttttataggcacagaaagtcccttggattagcccaaggtcattcagc
aagctgtgactcagaagtagggctgtgacaggaactggggtacccagacccaactcctgg
gtctggcctccacggagtctgttgcagggggtgtgcttactgcctgctctgcacccacag
ATGATGCCAGCTGGCTGCACGCAGGGCCACCCCACAACGAGTACATGGAGCAGAGTTTCC
AGGGCCTGAGTAGCATCCTGAACCTGCCTCAGCCGGAGCTCGCGGAGGAGGCTGCCCAGC
GGCACACACAGCTCACAGGCCCTGCGCTCGAGGCCTGGACAGACAGGGAACTGAGCAGCT
TCTGGTCCGTGGCTGGACTGTGTGCCATAGGCCCCTCTCCCTGCCCCTCCCTGGAGCCCT
GCAGACTGACCAGCTGGAGCTCTCTGTCCCCCGACCCCAAATCAGAGCTGGGGCCTGTCA
AAGCAGACGGGCGACTCAGGTAGCAGGGCCCCAGCCAGTACCCGTGGAGGACCCGGGAAA
TTGCACCTTACAGACAGTGGAGGGGTGTCCCCTCCCACAGGCAAGAACCAGAGGCCCAGG
CTGCACACCCATTTCAGCCATCAAGAACCCACACAGACGGCAGGGAAGGTGGACACAGTA
TGAACTACTGCTGATGTCTCTGTTGGGGATCAGAGGGCTGGCGGGAACGCGAGAAGGGCA
CCAGCAGCATTCCACACCCAGCTCTTCCTCACCTTCCTGTCTAGTTTGAATTTCTTTTTT
TTCTTTTTTTTTTTTTTTTTTTAATTTAAAAAGGAAAATGGGTGGTTGGGAGAGAAACTA
GAACAGAAGATGTGCAATAGGGCTCAGAGCAGCCCCAGGAAGTGGGCCATGTCTGTGGGG
AGCAGGGGCTTGCTGAGCCCACCTGCTATTGTTCTGCACGAGGCTGGGCCTGCCTCACTC
TCCAGGGCCTCATGCCCCATTCTGGGCCTGTGGTGCTCGTGGCTGAGGCTCCACAGGGCT
GCAAGTGCCCTGCCAGGCTCTAAGGCCCGAAGAACAGGTGATATCGGGGGCGCTGCAGAG
CTGGGCTCTAGCAGGACAGTTCTTTTGTAGCCAGGGGACCCTAGAAGTGGGGTGGGGCGG
CTCCAGGGCTTTCCAGCATACCCTGCCCCTGGATGGGAAAGGCAGGGTCAGGGCCCACTG
AGACCCATGCAGAGTTTCCAGGTGTGCACTGGAAGTGAGGTCACATGAGCAGCGTGGGAA
GAAGACTCTGTCAAGACTCTCAGAAGAACCTGGAGTAATTGTGCCTGAAGCTCAGCGTGA
AGTCTGAAATATGCAACAGAAGAAATATATCTCTATCTCTCTA
ctctgggctctgtgtttttcctcctgggtgtcaggaagccatcaccattcattgggcctt
ctccagaagtcttagctggtactttggtagccttgagaaggtaaagatctcattcctcca
gattaagaacagtttagaatccacccagagggactcaagaacccatctagcctgggtgca