Gene WNT9B Variant 1
DNA : 25.47 KbNT_010783
mRNA : 1464 bp NM_003396
CDS : 1074 bp NP_003387
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  114 bp
gggcggctgccccacccgcgacggggcggggcgagggcggtggggccaatggggcggggg
gctcgccgcccggggctggggagcctcccaatctcctcctttcccagcgccgcctgcccc
gccccacccgggtttaaagtcccgcgggcgggtggtggcggagctgcgagcttgagcggc
GCGAGGAGATGCTAGAGGGCGCAGCGCCGCCAGCACCATGCGCCCCCCGCCCGCGCTGGC
CCTGGCCGGGCTCTGCCTGCTGGCGCTGCCCGCCGCCGCCGCCTCCTACTTCGG
gtcagtgcccgccgcgccccccgcccgctccccggcctgcctgtctctccctcctgcgct
acagctgggccaatttttccctcccgctgtccttggccccgccgaggtctcgaactcaga
ccctagcccggcgcgacccaacccacttcgcagtcggagttcgcgccctgagttcggtct
EXON 2  257 bp
gcaacctttgttacatgaaccttggtttcctaatctgtaaaatggggacgggacctccag
cgggtcagcctgctgcccagaagggcagtaaatgaagcccctgaggaggccccttccctt
catttgcccctcaccaccatccccaaggctcacctgtctccctcctctcgctctctctag
CCTGACCGGGCGGGAAGTCCTGACGCCCTTCCCAGGATTGGGCACTGCGGCAGCCCCGGC
ACAGGGCGGGGCCCACCTGAAGCAGTGTGACCTGCTGAAGCTGTCCCGGCGGCAGAAGCA
GCTCTGCCGGAGGGAGCCCGGCCTGGCTGAGACCCTGAGGGATGCTGCGCACCTCGGCCT
GCTTGAGTGCCAGTTTCAGTTCCGGCATGAGCGCTGGAACTGTAGCCTGGAGGGCAGGAT
GGGCCTGCTCAAGAGAG
gtggggaggagggctaggggacggggagggctgggggaagaagccttcagggaggaggag
gctgggagaggctgccctttcctttttcctggctcccgtgcccaggccacactgcccttc
ctgccctagcacggtcccaaatgagaagagtcacaagagttaatgaggggcagttgaagg
EXON 3  266 bp
ggcagttgacagggagacccacccggagctgtgtcctcaagccacattctcttgtcctgc
ccatcacagcgctgccaccaccgcctctggccctcagagggcggcaggcaacctctaagc
ttcctcctttcctctcttccccctttcctccctccctatgcccctgggtgcccgatccag
GCTTCAAAGAGACAGCTTTCCTGTACGCGGTGTCCTCTGCCGCCCTCACCCACACCCTGG
CCCGGGCCTGCAGCGCTGGGCGCATGGAGCGCTGCACCTGTGATGACTCTCCGGGGCTGG
AGAGCCGGCAGGCCTGGCAGTGGGGCGTGTGCGGTGACAACCTCAAGTACAGCACCAAGT
TTCTGAGCAACTTCCTGGGGTCCAAGAGAGGAAACAAGGACCTGCGGGCACGGGCAGACG
CCCACAATACCCACGTGGGCATCAAG
gtgagcatgtccctggctgcccgcagtgccttcccaccagggtacacagctggggagcat
ggcttgaaggaggccagcaccccactccccaaaatacatgaagagccgtgaacttcataa
aggcaggatgaacttcacgtcttcaaccagcattcccttggcatctactctgggctgtga
EXON 4  827 bp
tcagtcgcgtaagttgtctattccacaagaactccaggccaaggggaggagctggggctg
agaccctgggtctctttcccattctcctgcctctgccctgctggggttggtgctctgggg
gcaggctctggctgctgggcccaggcctctgaccacgcctctgttctgcctcccccacag
GCTGTGAAGAGTGGCCTCAGGACCACGTGTAAGTGCCATGGCGTATCAGGCTCCTGTGCC
GTGCGCACCTGCTGGAAGCAGCTCTCCCCGTTCCGTGAGACGGGCCAGGTGCTGAAACTG
CGCTATGACTCGGCTGTCAAGGTGTCCAGTGCCACCAATGAGGCCTTGGGCCGCCTAGAG
CTGTGGGCCCCTGCCAGGCAGGGCAGCCTCACCAAAGGCCTGGCCCCAAGGTCTGGGGAC
CTGGTGTACATGGAGGACTCACCCAGCTTCTGCCGGCCCAGCAAGTACTCACCTGGCACA
GCAGGTAGGGTGTGCTCCCGGGAGGCCAGCTGCAGCAGCCTGTGCTGCGGGCGGGGCTAT
GACACCCAGAGCCGCCTGGTGGCCTTCTCCTGCCACTGCCAGGTGCAGTGGTGCTGCTAC
GTGGAGTGCCAGCAATGTGTGCAGGAGGAGCTTGTGTACACCTGCAAGCACTAGGCCTAC
TGCCCAGCAAGCCAGTCTGGCACTGCCAGGACCTCCTGTGGCACCCTTCAAGCTGCCCAG
CCGGCCCTCTGGGCAGACTGTCATCACATGCATGCATAAACCGGCATGTGTGCCAATGCA
CACGAGTGTGCCACTCACCACCATTCCTTGGCCAGCCTTTTGCCTCCCTCGATACTCAAC
AAAGAGAAGCAAAGCCTCCTCCCTTAACCCAAGCATCCCCAACCTTGTTGAGGACTTGGA
GAGGAGGGCAGAGTGAGAAAGACATGGAGGGAAATAAGGGAGACCAAGAGCACAGCAGGA
CTGAAATTTTGGACGGGAGAGAGGGGCTATTCCATCTTGCTTCCTGG
gatgaatggcttggagccagcatgttcttgggaggtgaactgctgggctaggaatgccaa
ggcaggcagtgccagctggaagtgaaggcgggagcctggctgagatgggtcaatcgggtc
ctgtggccctgctcaggtgcagtgggctccaggtgtcacacacctccaccactcccctgg