Gene WNT3 Variant 1
DNA : 54.22 KbNT_010783
mRNA : 1493 bp NM_030753
CDS : 1068 bp NP_110380
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  199 bp
gggcgatgcccttcccggagcccgagttgtgggccgggcgggaggggcgcgtgattgaca
ggctgaactacagactcatctcttaccttaggccgcgggcgctgattggctgctcgctga
catcctcaaacccggctgctccgcgctgggctcgggaggggggcggctgcgggtggaggt
GCGCTTCTGACAAGCCCGAAAGTCATTTCCAATCTCAAGTGGACTTTGTTCCAACTATTG
GGGGCGTCGCTCCCCCTCTTCATGGTCGCGGGCAAACTTCCTCCTCGGCGCCTCTTCTAA
TGGAGCCCCACCTGCTCGGGCTGCTCCTCGGCCTCCTGCTCGGTGGCACCAGGGTCCTCG
CTGGCTACCCAATTTGGTG
gtaagactcgcctcttgtctgcccgcggcccggtttctccgccgcgtccggggaaggtgg
gggcgccggctgggggtgggccgctgcagggctggggctcctctcctcgcctccctccag
ccccccacccgcccacccctcctggattttctgctggtgtcgccttcagaatccaactcc
EXON 2  242 bp
tcagagctctgcgctttgaggggcggcatgctcccgaggtcaaaggtagcacattcaggt
gccagggcacaggccctctgcctctccacctaccccggagggttcacaaagcggccatgg
tgcccaggatgggctctgtgctttgtgcccacagtgttactaccctctgtctgcctgcag
GTCCCTGGCCCTGGGCCAGCAGTACACATCTCTGGGCTCACAGCCCCTGCTCTGCGGCTC
CATCCCAGGCCTGGTCCCCAAGCAACTGCGCTTCTGCCGCAATTACATCGAGATCATGCC
CAGCGTGGCCGAGGGCGTGAAGCTGGGCATCCAGGAGTGCCAGCACCAGTTCCGGGGCCG
CCGCTGGAACTGCACCACCATAGATGACAGCCTGGCCATCTTTGGGCCCGTCCTCGACAA
AG
gtactgccttggggctgagggggggggaggggctgggtggggggagggatcaggactgta
tgcccttccaccccagtcagggtgcctcttctctgaagccagggtccctctgggagggtg
ataaatttggttgcatgactgccacaccttcccaggcgctgctgggggctgggccgcctt
EXON 3  266 bp
ccaactgggtctaaaccagccaaagagggtggggaagctgcctccctcttgcctcagggc
tggtgagctcttcaactcttcctggcctcgttcccctcacgtcctggcctgggaggtgga
ggcagggcaggcgctcccaggccgggtcctgagtgctgcctccccacgacctccccgcag
CCACCCGCGAGTCGGCCTTCGTTCACGCCATCGCCTCGGCCGGCGTGGCCTTCGCCGTCA
CCCGCTCCTGCGCCGAGGGCACCTCCACCATTTGCGGCTGTGACTCGCATCATAAGGGGC
CGCCTGGCGAAGGCTGGAAGTGGGGCGGCTGCAGCGAGGACGCTGACTTCGGCGTGTTAG
TGTCCAGGGAGTTCGCGGATGCGCGCGAGAACAGGCCGGACGCGCGCTCGGCCATGAACA
AGCACAACAACGAGGCGGGCCGCACG
gtgagcccggctaccctccccaaacccttcagggagcagccccccgcttcccctccggag
ctgccctggcccccacctcaccccttccggcagccctgtgggtcgcgggctccttttccc
cttggccaggcttggcctcctccccaccccacagccacttcgtctgtccaccctccttcc
EXON 4  488 bp
ggggagggaaacatggtcactattctttaggtcttgcctcagtccccatcagttctcttc
ctgtcacagaggagtagagaaggctggagggaagggggtgggcagtggcagagagggaag
gcctggatgtgccccctcgtggggtcggtctgttggccagctgccacttctctcccccag
ACTATCCTGGACCACATGCACCTCAAATGCAAGTGCCACGGGCTGTCGGGCAGCTGTGAG
GTGAAGACCTGCTGGTGGGCGCAGCCTGACTTCCGTGCCATCGGTGACTTCCTCAAGGAC
AAGTATGACAGCGCCTCGGAGATGGTAGTAGAGAAGCACCGTGAGTCCCGAGGCTGGGTG
GAGACCCTCCGGGCCAAGTACTCGCTCTTCAAGCCACCCACGGAGAGGGACCTGGTCTAC
TACGAGAACTCCCCCAACTTTTGTGAGCCCAACCCAGAGACGGGTTCCTTTGGCACAAGG
GACCGGACTTGCAATGTCACCTCCCACGGCATCGATGGCTGCGATCTGCTCTGCTGTGGC
CGGGGCCACAACACGAGGACGGAGAAGCGGAAGGAAAAATGCCACTGCATCTTCCACTGG
TGCTGCTACGTCAGCTGCCAGGAGTGTATTCGCATCTACGACGTGCACACCTGCAAGTAG
GGCACCAG
gtagggctccgggaagcaggggggaggctgggagcctgggcgcagggaatggggttgttt
gcccatctcgtcttcttgacgacccccttctgtttctaagctatccaagacacacaagtt
cccacagccaaaataggaagctaggatttttcaagcatccgtgggaatggtccttgggca
EXON 5  298 bp
ctccctcaacagcaggcccaaagcacagaggagagcgtggagaaaccacccaagtcctca
tcacctctgagcaccagggacacgttcagatccatcagcagcctctgatctttgaacccc
aatgggtggtctctgggaatggaattatgtttctaattcttcctcttgattttccccaag
GGCGCTGGGAAGGGGTGAAGTGTGTGGCTGGGCGGATTCAGCGAAGTCTCATGGGAAGCA
GGACCTAGAGCCGGGCACAGCCCTCAGCGTCAGACAGCAAGGAACTGTCACCAGCCGCAC
GCGTGGTAAATGACCCAGACCCAACTCGCCTGTGGACGGGGAGGCTCTCCCTCTCTCTCA
TCTTACATTTCTCACCCTACTCTGGATGGTGTGTGGTTTTTAAAGAAGGGGGCTTTCTTT
TTAGTTCTCTAGGGTCTGATAGGAACAGACCTGAGGCTTATCTTTGCACATGTTAAAG
aaaataaaaatgaaaaaaaatttgactccaacagaacaggctgggctaatgtgagctctc
agcctggcagtcaagacatcagcatgggcaaggttctgtttccaaactgctgcttctggt
gacattccaagacgcctggagggtgggagtcaggaagtaggacacacccctgcagtctcc