Gene USP6 Variant 1
DNA : 46.64 KbNT_010718
mRNA : 7859 bp NM_004505
CDS : 2361 bp NP_004496
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1698 bp
cagctgagccaggttttagataacatgtctagaaaagtgggcccctactgtgtgcctggc
actttccgcacatgatcctctagctagaatatccaagggtcatggagagaaatacccagt
taaaatatcagaaatgaaaaagtgataccattagagacactaaaaagacgattagagata
CTAAAAATACCATTAAGTAATAGTATTAGCTTTTGTATTCTGAGATTCAACAGCAGCAGT
CACTTCCCTCCACTCCTATGTGTATCCCAGGACCACCCTGGGCGGGGAGGGCTGAGGTCA
GGGAGGTCTGAAGCTGGTCCTGGGCTCCGGGGGTGACAGTGATGAGGAACTGGGTGCACA
CATGAGTGGGGCAGCCGGGCCTGGCCAGAGAAGCAACACACACGTGCACAGACATGTTTA
TCCACATACACATGTGCACGCATGTGCACAAACACATTGCAGGCAGGCATGTTGACGCCT
CAGGCAGCGGAGGACCCTGACTCTGGGCCCTGCTGACCCAGGCAAGGCCCCATTGTGATG
CGTGCCATGACCTCAGAATGTCACTGGTGCTTAGCACCTATCCGCTCTCCAGACTGCGTC
TGTGTTCTACGGCAGTTACACACACGCAGTGGTATTCACAAGCGGTTTTGTGGACTCAAA
GGTTTTCTCCCTGAGAGGCATAACCCAGGCCAGCTGATTCATCAGAATCAGGTGAGTGTG
ACCTGCTCTCTTCCCTCCAGGCTGACTTGGGGACAGTGGCTATGGTATGGGCGGTGTTGG
CCTCTGGGCAGCTACAGAGGAGGGTCATCCCTGAGCACTCACCGGGCGCCCGTTCTACAC
TGCCCATGTAGACGATTTTCTCTTTCGTCTTCATGGTGGCTTCGTAGAGTGGGTGCTGTT
CCCGAATGTACCCATTCGACAGGTGAGCCGTCTGGGGTCAGAGAGGCAGTAACTGGCCTG
GGAATCCAGACAAGACCCTGGGTTTTGCTCTCAGCCCTGCTGTGTGCCATGCTAGACTTC
AGGCCTCAACCCTGAGACCTCCCTGCTCTAGATCCCAAATCTGCCCAGATTTCCGATCCC
AATGGGGCAGAGCCTGGCCCTGGCAGAGACACTGGGATGGATCCACTGTGGGTGGGGAGG
AGGGAAGGGTCCTCAGAACACACCTGGGGCCTAAGCTGGGTCTTGATGGTCACTGTGGGA
CCCACTGGACACACACAGTCCCTTGTCTGGGAGTGGCATGGGGAGCCTTCTGCCCTTGGG
CAGTTGTGGAAAGTGAAGGAGCCCTGGAGAGCTGGCTGAGGGGAGACTATCTTCCCTTGT
GTTCAAAGGGGTCCAGGCACTGGGGCTCTCCCCAAGTATTTCTTATTCTGTCTGGCCTCG
CTTTCCTTTTGCCCTGAGTATTCTCAGGAGGGACGGTCCATCTAGATGTCCTCCAGGAGC
AAGGACCCACTGTTCTTCATCAGTGACCCAGGAAAATGAAGCCCCCTCCTGTGGGGACAG
CTCAGAATGGTGGAGTCCACAGTCCCTCCCTGAGAGACATGGTTTCCATGAGCACAGTGG
CTGCTTTGGAGACAGTAATCATTTTCATCCCCAAAACCAAACACACTCCTGCTCAAATGG
TGTTATTGCTAAAGCAGCTTCACTGGTTAGACTGAAGGGCCATGGTAGCCCAAGTGATGA
GCGGGGTAGAATGGAGCAGTCAGGAGAGATCTTGTTCCCCGTAGGAAACTGGGCATCTCT
GTGGCCCTGAACATCCCAGGAGGCCGATCGTACAGAGACCTCTGGTGCCTGACCGCAGTT
CACATCCACATCCCTGGAATAGACCATCACAGGCTCTTCACCCTTGGCAGGTGGACACCA
TTCAACCTGCCGGGGCAG
gtgtgtgcccatttcatggcatatggggacaaccggattctctgtccaggtcccactctt
ctcgagtccttgggaagatgcccacccctgcttggggcttcagactgcagagacccatgg
aggtgtgggccatggggtttggcccctttttaccggagtgcagtggtggaatgaaggtta
EXON 2  73 bp
cttcagactgcagagacccatggaggtgtgggccatggggtttggcccctttttaccgga
gtgcagtggtggaatgaaggttatacaaccagccagcatctgggagcccggtgggagcgg
ttcaggtgttctccgaagctgtcgggtacagtgtaacctttagacaattttgtctcacag
GATGGACATGGTAGAGAATGCAGATAGTTTGCAGGCACAGGAGCGGAAGGACATACTTAT
GAAGTATGACAAG
gtacagttcggtctgctccttggagggaggcctcttccagtgcgccctggtcaaagggtc
ctgggttccctaggagcacagggcagggacgggtggccaatacccccaggcccttgcacc
ctttaccttggacccctcaccaaggctccctctgggttacagggacaccgagctgggctg
EXON 3  87 bp
cttatgaagtatgacaaggtacagttcggtctgctccttggagggaggcctcttccagtg
cgccctggtcaaagggtcctgggttccctaggagcacagggcagggacgggtggccaata
cccccaggcccttgcaccctttaccttggacccctcaccaaggctccctctgggttacag
GGACACCGAGCTGGGCTGCCAGAGGACAAGGGGCCTGAGCCCGTTGGAATCAACAGCAGC
ATTGATCGTTTTGGCATTTTGCAGTGA
gtcatcctctatgctcccctcacccctaaagcagctgtctcagctcagggatgggtttgc
ttttagaaaggcctttctgatgcaggacatgtctcgctaggtcgggccaacctcttttcc
agggtcagaactcctccctggctcccctgcaggtccagcccgaggttgttgttaggccag
EXON 4  36 bp
ccctcctgggagtcagagccacaggaaggcccttgtcctcccttccctgtgccttctccc
gggctgagccctgagctggatagggacagagccagtcctttctgggggtcggctcccagg
cttgggcggctccaggccctgtgcacgtcctcagctctgcctgggttgccttacagtgag
ACGGAGCTGCCTCCTGTGACTGCACGGGAGGCGAAG
gtaagagcctgatgcgtggaggggctggtccagggacgtagggactgggcgggtggtcag
tgaggcagaggaagcagctggcctgggcggtggcgggtgagggcaacacgctgtcactgg
gaggggcagcagagacctgaccccaagttgctgtaactttggcagtttgataaaattcca
EXON 5  81 bp
ggtcccaaagccagcccattggtgctcatttgctcaaaggctctcagcccttagggtctg
cccttccctggctccttccagttgggtcccaccagggctccagagcccaagactcagcat
ccatgggcggctctgggaagcctggcagctccactaactccaacatgcctcatttgacag
AAAATTCGGCGGGAGATGACACGAACGAGCAAGTGGATGGAAATGCTGGGAGAATGGGAG
ACATATAAGCACAGTAGCAAA
gtaatgtgtggagggagaggcccctggaagcactctctgcagaaacaggggacaggcacc
catggctgtggcctggcaccgtcagcctctcagagggcgggtggcacactgtcctcgccc
agaggactgcaggcctggtcaccagattgcctgcctattcgtgcaagtgtcaccttgctg
EXON 6  108 bp
tttagactctgagtgtccatccactctttcagtcctgggaagggagaccctgtcccagct
tgatctcgcctctactgaggaatcatggggccaaaactgacaatttccagaatccccagg
ctctggtcctcactggggtcaccccatggcctgtgacaccagattcttttctgcccacag
CTCATAGATCGAGTGTACAAGGGAATTCCCATGAACATCCGGGGCCCGGTGTGGTCAGTC
CTCCTGAACATTCAGGAAATCAAGTTGAAAAACCCCGGAAGATACCAG
gtatgctcagccagagcacaacaaacaggacaggccgtgtcaggggcccaggtctccagc
tggagggaacgtcaagcccaccctggggtgggggggtgggaggggatggttagatgcaca
tcctgggcatggacggtgacacagtcaccacagacaaactcggctgtggtgaccctccct
EXON 7  110 bp
aactcggctgtggtgaccctccctggcctcagtagcaagccaaaaagcagctttctgcag
aaggaaaccttccttctttccttccttcccgaagtgctgactgtgggctgactgccattt
ggggcagggagtcttccatctgttctgaggctgcttcctcctcttggccctgccctacag
ATCATGAAGGAGAGGGGCAAGAGGTCATCTGAACACATCCACCACATCGACCTGGACGTG
AGGACGACTCTCCGGAACCATGTCTTCTTTAGGGATCGATATGGAGCCAA
gtaagcctacgggagccacacagtcccagcagagatggggtgaacgagagggatggggac
ttccccggagcagaagccagggtcacccaggagggatgacagagctgccaagagctctcc
tggcccagggagcagccggcaccatgaaccgagcacctccctggttccaagccctgggcc
EXON 8  49 bp
gcatgtcacagatgtggattttactgaaacatttcttcaacagtctcaggccctgaagag
ctcactgcttatctggtgaatcatctgaacctgaaatgggatttgttaggatttgtagac
aaagtgaaactaacagcatctgcacaaaccaaaccatagccccctttctgtgtttcctag
GCAGAGGGAACTATTCTACATCCTCCTGGCCTATTCGGAGTATAACCCG
gtgagtattcccggcagtgaggttcccaggctgtatttccatattcacaggagtgggtgt
ctggtgggggtgtcgttgcttcttttaaagttggtatttgtgactcaccaggatatagga
ggtaggattctaggtcaccgctggcataaacctccaagcaagggggtggtctcaaggggt
EXON 9  121 bp
aggtgctgaagtgcctgatggactttgctcttgtcatgaaatgaatttgcatcctgagga
agcctcttcttcagaggaagcctccccagtcacctctgccctctccaatgacatgagtcc
tcccaggtgacctcagccctcccaggtgatgtccttccatggtgactctggctcttgcag
GAGGTGGGCTACTGCAGGGACCTGAGCCACATCACCGCCTTGTTCCTCCTTTATCTGCCT
GAGGAGGACGCATTCTGGGCACTGGTGCAGCTGCTGGCCAGTGAGAGGCACTCCCTGCCA
G
gtaggtgaacagctgcccgtggggcctcacgcagccagacccgggaaagccactgtggcc
aggtgatctcggctttcagccaaggcacactccttgtgttgccagcttgttgggagcatt
taggacgtctctgctgagggtcccacaggagtccgcagctgacccccacaacccaagtca
EXON 10  95 bp
ggctccaggggatgttcctgtcccacctccccagggcaaaggccgcatggtagggtcacc
agatgggagggcgggaggccttggggtttgggggcctctgcagctgcccagctctttcag
ctgatggctccacaccttgggggaaggctctgatttcatgatgggctgggggcttctcag
GATTCCACAGCCCAAATGGTGGGACAGTCCAGGGGCTCCAAGACCAACAGGAGCATGTGG
TACCCAAGTCACAACCCAAGACCATGTGGCATCAG
gtgagtttatggtcccctcggctcttctcagaggccctgcctcctgtggggctgtaggag
cagggggactggagtcccttgtgggactggtgactggcggagtcccagctagggcctgac
ctgggacgtcgggttctccatgggctgggagttggtttcctttcatgccctggaggagac
EXON 11  66 bp
cctgcagagcagggcaaagggcagtgtgtccaccgggagtgtgggaaggggacagtgttg
tggggagttctggacaccgcccagtgttctgcactaggggaaaggtcttcagaggccctg
gaagatggaggtttttagggcagcccagggggccctgagcacctctgttcatcccatcag
GACAAGGAAGGTCTATGCGGGCAGTGTGCCTCGTTAGGCTGCCTTCTCCGGAACCTGATT
GACGGG
gtaaggaggcatagggagaccctggctcagggaccctccttgccctgcagtgccgtgctt
ccccagcccgggggtctggctcactcccagcccacaggaggctcaggcgggtccccgaag
gacacacaagcaaaaccctctgcccaagaggggtcatcccagggcaatggctgggactca
EXON 12  100 bp
aaatgagtacccccccatgagaagttgcaagaccttttctgactcagcattctggagggc
tcaggtgaccctcatggggaaggtcactgactctggagactgaagccccagtgtgcgcag
ctcgagccaccagccccagcctggaagggccaggttctctcatacctgctgtccccacag
ATCTCTCTCGGGCTCACCCTGCGCCTGTGGGACGTGTATTTGGTGGAAGGAGAACAGGTG
TTGATGCCAATAACCAGCATTGCTCTTAAGGTTCAGCAGA
gtaagtctacgtgtgcccagtggggcctggggagccctgcagtcagaccccgactggccc
aagggcagcttcctcacactgtcctcatgatcctctgttctggcccagagggaggtctgg
ccaggtgggctgggcagggcactgtgacaccgagcccatcccccacatgacccagatgaa
EXON 13  153 bp
gtggtgagcacttccctgtccagatcaccccccagccacagtctcctgtgtacatctgga
tgcctggggtggccacaaaaggattcggcaccgcccagtgggagactgaagtggccacag
ggtatgagctgtgaccattcccagggaactctcctggcctgatatccaccctgtccctag
AGCGCCTCATGAAGACATCCAGGTGTGGCCTGTGGGCACGTCTGCGGAACCAATTCTTCG
ATACCTGGGCCATGAACGATGACACCGTGCTCAAGCATCTTAGGGCCTCTACGAAGAAAC
TAACAAGGAAGCAAGGGGACCTGCCACCCCCAG
gtgggctccagtgccatgtcccctcccatgtcagcctctggggcagtcaatagtgggcgg
gtgccccggaccagcaaccctactacctgggccttcctcttcaccttttcttcctcctct
tcctcctggactctaagaaagtacaggaggcccaccggtcctcagggcaggcactcagtg
EXON 14  420 bp
tgccaggcagcacacacccctccctctgggatcagcagactacaggcgtgtcgtcagtgt
cagaccacaggggccacacagagaccccaaggactccagagatgcaggcaggtggggccc
agcccggaaaggcctgcatgggctcactggagatgctgaccacgtctgttttcctttcag
CCAAACGCGAGCAAGGGTCCTTGGCACCCAGGCCTGTGCCGGCTTCACGTGGTGGGAAGA
CCCTCTGCAAGGGGTATAGGCAGGCCCCTCCAGGCCCACCAGCCCAGTTCCAGCGGCCCA
TTTGCTCAGCTTCCCCGCCATGGGCATCTCGTTTTTCCACGCCCTGTCCTGGTGGGGCTG
TCCGGGAAGACACGTACCCTGTGGGCACTCAGGGTGTGCCCAGCCTGGCCCTGGCTCAGG
GAGGACCTCAGGGTTCCTGGAGATTCCTGGAGTGGAAGTCAATGCCCCGGCTCCCAACGG
ACCTGGATATAGGGGGCCCTTGGTTCCCCCATTATGATTTTGAATGGAGCTGCTGGGTCC
GTGCCATATCCCAGGAGGACCAGCTGGCCACCTGCTGGCAGGCTGAACACTGCGGAGAGG

gtgaggttggctttcactgcactgagccacaatgtgggcatggacttcccggccctgcag
tgcacccagcactgattccgaccgggatacctcctttgcagctagggacgagcagcagtg
cgctcccacttcagggccttgcctctgccacctctacttggaaagttctcagttccctcc
EXON 15  75 bp
cctaatgatgcatttctcagaatgtaacctcatcattaagcaatgcatgtactaaaatta
gctagattttaaaacttccgatttaggaataagatgtctttaaaaaaaaaaaacagaagc
aatcaagtgggtgtaaattagacagataagaaattaacacattcctatctgtccttccag
TTCACAACAAAGATATGAGTTGGCCTGAGGAGATGTCTTTTACAGCAAATAGTAGTAAAA
TAGATAGACAAAAGG
gtaagtctccagtattattttttaaagagattattttaaatgtattttttttcttctttc
aactattaaagtgctaacaacttttggttttctagttcaaaagtaattagggcccttctt
tttcttttttcctgaagcagcatttgatgttggcaaacccaccatcaaattattttctaa
EXON 16  139 bp
ctgttgccagacataccatgaaaagccttctctagcatttcaaagacctgctagagaatt
attagcaccatttagctgattatgagagttataaaaaatcttttcattgaatataagtaa
ctgtttgtgccatggcatattactacagctaagctttggttctcatattgtttgttccag
TTCCCACAGAAAAGGGAGCCACAGGTCTAAGCAACCTGGGAAACACATGCTTCATGAACT
CAAGCATCCAGTGCGTTAGTAACACACAGCCACTGACACAGTATTTTATCTCAGGGAGAC
ATCTTTATGAACTCAACAG
gtaaactttcttgagtcactggcctcttaacctgtgactttgatataaacccactatcac
ctaaatttcctcttttttcaccctgcgggagaaagattttatcttatttgccctatttaa
tatgaaataggccaaggaatacatctcttgtttcaaaaagaaaagatattttgatgtgag
EXON 17  106 bp
tttcaccctgcgggagaaagattttatcttatttgccctatttaatatgaaataggccaa
ggaatacatctcttgtttcaaaaagaaaagatattttgatgtgagatgctaggcatcttt
gcccacatgattgtgatttatgagaatctttggcaacaaattttcctctcaaacttctag
GACAAATCCCATTGGTATGAAGGGGCATATGGCTAAATGCTATGGTGATTTAGTGCAGGA
ACTCTGGAGTGGAACTCAGAAGAGTGTTGCCCCATTAAAGCTTCGG
gtaagcaggttaaaataatataaaagtatttaattcctaaatagttgtttaatcattttt
ctctacttgttttttgtgtttagccttttagcttaatgaacgtttttggatcctttactt
ggtataaacaagaggccaaattcttttgcttgtttaaatatttgcaaaatactactgtat
EXON 18  174 bp
tcatttgacattaagattcaaaagatttcatgattatccaaaatacatttgttgaaatgg
aggcagactaagtactatactatttattttcttacaatggctctgattggattataggac
atgttcattccaaattttatgggtaggaaataatgactgtgacttctcttatatttatag
CGGACCATAGCAAAATATGCTCCCAAGTTTGATGGGTTTCAGCAACAAGACTCCCAAGAA
CTTCTGGCTTTTCTCTTGGATGGTCTTCATGAAGATCTCAACCGAGTCCATGAAAAGCCA
TATGTGGAACTGAAGGACAGTGATGGCCGACCAGACTGGGAAGTAGCTGCAGAG
gtttgtcagttttgagtttctaatgtaagcaatagacaaaatgttctgaccacaaataca
tgtagcacaacttaaatgcaaactaaactattctgagatcagaattttactgcaaaaatt
aaggaatttctatttctatgcttaattgttatgtgataatgccaaaacaaaaataccttt
EXON 19  175 bp
tgataagaacaaatgaaaaataggattttccatctcaatttaatattttatgttaaatga
agagtaaggattatattctttacttttaaatccaatatatttaaccagtttctgtgaatt
tatatagaaatgcctctcttttggattttgagagaaaattctcatcttttttattgctag
GCCTGGGACAACCATCTAAGAAGAAATAGATCAATTATTGTGGATTTGTTCCATGGGCAG
CTAAGATCTCAAGTCAAATGCAAGACATGTGGGCATATAAGTGTCCGATTTGACCCTTTC
AATTTTTTGTCTTTGCCACTACCAATGGACAGTTACATGGACTTAGAAATAACAG
gtaggtcacaaagttctgaaaaattacttgattccattaaatttactttatttaaatagc
ctgaatttgtaagcatagttatttgtttacaaataaagactggtagtcagcatattataa
tcgagcaacctaattttaggcatgacttgaggtttgaaagatgtagattggggcatgttt
EXON 20  152 bp
tactgatttcacttaatattatccctaagtaccatctgttttagtgtttacccataaaat
aaaaattctaggctgaaatatttgctattatatttacaggtcagatatatctgtacacag
catttaaggctttcaatgaaacctgcattttactgataaaagatcttttctctttactag
TGATTAAGTTAGATGGTACTACCCCTGTACGGTATGGACTAAGACTGAATATGGATGAAA
AGTACACAGGTTTAAAAAAACAGCTGAGGGATCTCTGTGGACTTAATTCAGAACAAATCC
TACTAGCAGAAGTACATGATTCCAACATAAAG
gtaatgttaactactctaagaaacttttgattctatccttcaaagatgacatttttctca
attatgatgatcagttgttaggttatgtgaccaagagagatactaaaacataacgaaaac
tgaacaacaacaaaaaatgccaagttttccaacccagaaacttaaaagagttttctacca
EXON 21  212 bp
gttagggaagtaaaactggaaattaaaatcttccaataaatctagaattatttatactat
gatttctccctgccctgtgttaagagactacactgtctctcgtcctcaggatacttgaga
aaagagcaaagatgaaaataccacaagcttatgatgctgtacttatctttgaatttgtag
ATTTCTCCTCTTCACCATCTACAAATGGAATGTTCACCCTAACTACCAATGGGGACCTAC
CCAAACCAATATTCATCCCCAATGGAATGCCAAACACTGTTGTGCCATGTGGAACTGAGA
AGAACTTCACAAATGGAATGGTTAATGGTCACATGCCATCTCTTCCTGACAGCCCCTTTA
CAGGTTACATCATTGCAGTCCACCGAAAAATG
gttagttaaatgttaggcaactcactgccagtcttgctagtgtcatttgtgaaatagcca
ttttctgtctttgcaacatcattgaatgcattttcttctcttttttctttaatttttaaa
aatttaatacttttacaaattttatttttttacttttctatcctgtcctcaaaacctgtt
EXON 22  185 bp
tgactccactgtaaaccgttctctttgtgtcaataaagatggttttataaacatagagaa
gaatgtgatagtgactaatttgaaatggtgataatgcctatcattggcagagttagaaga
actaaagggaggaatcagaggcctgtcttctcaactctctattctcgtttgtacatacag
ATGAGGACAGAACTGTATTTCCTGTCACCTCAGGAGAATCGCCCCAGCCTCTTTGGAATG
CCATTGATTGTTCCATGCACTGTGCATACCCGGAAGAAAGACCTATATGATGCGGTTTGG
ATTCAAGTATCCTGGTTAGCAAGACCACTCCCACCTCAGGAAGCTAGTATTCATGCCCAG
GATCG
gtgagttcaggggatccatctaaacctgtggtttccaaactctagaaaaataatttatat
gaattctacatgacagatagggcccagcccatgtcaagtttggcgcccagccaaaataag
ttatttaaataattatttaaagtatttattttaaataaatactttattttggaagaacca
EXON 23  87 bp
agagtgtatttggtactgggctgcagctaatggattagggtaagtaacattgagctgtca
acatgagcatactgctgtggcaaatgccccttcctaggattacttcaagagaagatgaaa
aggagttggacctcgaaccagaaatgcttcttacactctttttgttctcttctgtttcag
TGATAACTGTATGGGCTATCAATATCCATTCACTCTACGAGTTGTGCAGAAAGATGGGAA
CTCCTGTGCTTGGTGCCCACAGTATAG
gtaaagtgacctgcaaaagaattactttagtagaatttcagctttagatattatacaatt
ttcctaagatttccaattttgagaagtaaatagtgaataatgagaaacttaagaactgtg
gctgggcaccatggctcaggcctgtaatcccatcactttgagaagccgaggcgggtggat
EXON 24  121 bp
atgataataattattaataagtatccttacatttatcagagtctgaagttagaagcccat
gacaaattgtgaggcccaagaggaaagcagaaaagtaggaagggagaatattttttatta
agaaaatttaaattccttcataattatttcttcctctgtggatctttcccccctttttag
ATTTTGCAGAGGCTGTAAAATTGATTGTGGGGAAGACAGAGCTTTCATTGGAAATGCCTA
TATTGCTGTGGATTGGCACCCCACAGCCCTTCACCTTCGCTATCAAACATCCCAGGAAAG
G
gtaagaatttagggccaccgtaaaatggtggtttttatatgggaaatttcccccagtgta
actattatgccatttctgtttgacaatttaaaaacaaccagaaaaaccttcattggcatc
ctctatggcacctaatatattgacatgtttgcttgagctttttcattttccagcttctgg
EXON 25  192 bp
cctcggcctcctaaagtgctaggattacaggcctgagccatcatacccagccagttgtat
tttctttttccttataaagagtaaaataagggtgagtgaccgagcggttgatgcatagct
agatcaccagtttaaatgccttcccacacacccctttcctcctgttccctctacctacag
GTTGTAGATAAGCATGAGAGTGTGGAGCAGAGTCGGCGAGCGCAAGCCGAGCCCATCAAC
CTGGACAGCTGTCTCCGTGCTTTCACCAGTGAGGAAGAGCTAGGGGAAAGTGAGATGTAC
TACTGTTCCAAGTGTAAGACCCACTGCTTAGCAACAAAGAAGCTGGATCTCTGGAGGCTT
CCACCCTTCCTG
gtatgttacggtcctgcctctgagagagcaggaatctagcataaaagaaagaagacatga
acaaacaggaggttttgttatttttgagaataagacttttcctgcagcagtgtttaaaac
acattctgtacaaggtttttatgttgaatacagagatgaatctttctacaaatatttggt
EXON 26  289 bp
actagggcctgtgtagaggcctttatgaaaccatatttttgaagtctttaaaaaataatg
aagagtaaatgttctgttatatatttccaaacattcacatgtatttgacttgttttttcc
atgtaaattttgtatcttcagaaccctttaatgcgatgttttctacctttacttctccag
ATTATTCACCTTAAGCGATTTCAATTTGTAAATGATCAGTGGATAAAATCACAGAAAATT
GTCAGATTTCTTCGGGAAAGTTTTGATCCGAGTGCTTTTTTGGTACCACGAGACCCGGCC
CTCTGCCAGCATAAACCACTCACACCCCAGGGGGATGAGCTCTCCAAGCCCAGGATTCTG
GCAAGAGAGGTGAAGAAAGTGGATGCGCAGAGTTCGGCTGGAAAAGAGGACATGCTCCTA
AGCAAAAGCCCATCCTCACTCAGCGCTAACATCAGCAGCAGCCCAAAAG
gtgaggcctgggggccttatgcagttgctttcttgggactcctgtaggctacatatgttt
ctctgtcttctgttctggaacatcaggttggttgggtggaaggaacctatctggaatcag
acctatctgtatttgagctatgtaagttgtagcaagagattcagcctccctgaatctatt
EXON 27  437 bp
gaagaagacaaaaatgtaacttactggctacacaataggaaccaaagggtagccagtcat
gactcccctgtctttacctttgtgtgtacagttgcaaagctaacctcggagttagcattt
ggggctggcttactttctggcatttggatttgtgaatcttttcttctgtcctgttcacag
GTTCTCCTTCTTCATCAAGAAAAAGTGGAACCAGCTGTCCCTCCAGCAAAAACAGCAGCC
CTAATAGCAGCCCACGGACTTTGGGGAGGAGCAAAGGGAGGCTCCGGCTGCCCCAGATTG
GCAGCAAAAATAAGCCGTCAAGTAGTAAGAAGAACTTGGATGCCAGCAAAGAGAATGGGG
CTGGGCAGATCTGTGAGCTGGCTGACGCCTTGAGCCGAGGGCATATGCGGGGGGGCAGCC
AACCAGAGCTGGTCACTCCTCAGGACCATGAGGTAGCTTTGGCCAATGGATTCCTTTATG
AGCATGAAGCATGTGGCAATGGCTGTGGCGATGGCTACAGCAATGGTCAGCTTGGAAACC
ACAGTGAAGAAGACAGCACTGATGACCAAAGAGAAGACACTCATATTAAGCCTATTTATA
ATCTATATGCAATTTCA
gtaagtggtttattatacggttttcagagagtggtctgtgttttgttcacttgtcttcat
gtattcatcagcaagtatttttcaggtcctgctaatttcctagcattgagcttagtgata
gacaaagttaacattgaaatctgggctcacagatgtggtgtggtggctcacacctgtaat
EXON 28  93 bp
cttatgacttttgtattttgctttttgcttattttggttttagagaaagagggttctaaa
atattttctcacctattgatcatttacatgatcagtgttctcctgctcagatcttagtgc
tataccctggccatagtacagttaactactaacatacctccactctcttatctcttacag
TGCCATTCAGGAATTCTGAGTGGGGGCCATTACATCACTTATGCCAAAAACCCAAACTGC
AAGTGGTACTGTTATAATGACAGCAGCTGTGAG
gtaaacattctcaatctttgaatgaaagttagaatatcaacagaactggggaacatttgt
tgaaataatggactatctcttgaataggaaatagatatttctgttagaattaatatatag
atgctgtcagtattaaaggaacaaaagtgatatgcagagcagggaatgaaaacatgagta
EXON 29  2225 bp
agcaaacattggaaataatggggctcattttaaaggggcaggtgtgagacagccaaacta
gtgagcttattggaagcaatcaggttagtaattacagagggttggtcttccctttcctgg
caaggatttagagtcataatagtgatggctttttgttaaaggtttttcttgccctttcag
GAACTTCACCCTGATGAAATTGACACCGACTCTGCCTACATTCTTTTCTATGAGCAGCAG
GGGATAGACTACGCACAATTTCTGCCAAAGATTGATGGCAAAAAGATGGCAGACACAAGC
AGTACGGATGAAGACTCTGAGTCTGATTACGAAAAGTACTCTATGTTACAGTAAAGCTAC
CACTCTGGCTGCTAGACAGCTTGGTGGCGAGGGAGATGACTCCTTGTAGCTGATACTTGG
CAAAAGTGTCACTGAAAGACAAGCTAAATGTAGTTATTTTATCCTGTTAGAACAAAAATT
CTAATTAAAATAGTTAACTTGAAGAGTAGAAACAATTGTATTTTGAAGTCTCATACAAGC
TGTCTGATAGAGAACTTTCAGGCAGATCCCACCATTAGCCTGTAAACAAAAGGTGTGGCA
CCAGCCACCTGGGACCAAATAAGAATTGAATTGTGCTTGTCCAGATATGAACAAATATGT
AGTGAGTATAGAGTTTACCAATAATCATAACAAATATTAAAGATTTCCTTGGAGTCAGAG
GAAAAAACAAACAATTATAATGTTGTCTAGGGACGACATGATACGCTACCTCCTTTTTCC
TGAAGTTTTATTCCATTATATTGACAAGATGGAGAAAGCAAGATCATGAAGGTGTGCAAA
TGATTCTTACGGCATGGACAAGGATTTTTCAATTTATTTTTTAAACTGTTTCCATACCCT
TTCTTTTTCTTGCTTTTTGTTTTTGCCATTGTGTTTACGTTTGAGACACAACCAGTCATT
GGTGGCAGGGGCATAGAGTGGTCAGTCTGAAAGGGAGGCTCTCTTAAGAGCTATGTGCCT
TCCAACCAGAGGGAGACCCAGTAGAAAGAAAAACATCCTGGGAAATCCAGCTACCAGGGC
CCTCCCAGTGGAGGCATCTTACATTTAGGCTACTTCAAGTATCCTCAGAAATGTATTCTG
CACCCCCGGCCCCGCCCATGCTGAGGGAAGGGGAGCAGTTGCCAATATTTGCACCATCTT
CACATGCACATGTTGCAACAAGAGCTTCTGGGAAGGTAAGCGGCATCGGAGCTAGATCAC
GTTTCACAATTAGTGGTTATTCTTTTCTGTGTTTGTTTTGCACTTTAAAAAAGAGAGAAC
ACATGCAAATGAACTTGCTTGTGTGTATTTGATGGCTCTAAGGGCTATAAATTACAAACA
AAACACATCCCAGACATTAGGAGTTCATAAGTATATTTAATGAAATTGGTGGTTTTAGGA
AGTCAACTTTAGTTTTGCTTTGTTTGCATGTCCACTGGTTTTTTTATTTTGATATTTGTC
TTTTTTTAAATTTTACAGTAGTCATTGAAAGTTATGTTTCTTTGCTTACTTCATTTTTTC
CCTCTAATTATTTAAGATTGGAACAAAAGTATAAATATTATTTATTTGAGGTAGAATTTT
TTTCATGTAGTTTCTTAATATATACTTGAAGGAAATGTTTCACCTTATTTTTGGTCTTTG
TTTATTCATTTAGACCCTGCAAGTTGATTCTCATTGCCAGATTCCATTACCCTTTCTTCC
TCATAGGTAGTAATTACCAATGTAACTAAGCATTTGTGTTCTGATATCTGAGGCCAGTAA
CTATTAATATCTAGTTCTCAGAGCATTTGGAAAGGTTATCTTAAATGGCTACCTAAATTG
AAATCCTTTTCAGAAAAAATATAATTGCAAGTAGGTAGGAGTGGCCTAAATTGTCTAATG
TAATAAAGTCAGACAAAATGCACACTTTATAGTTTCAAGATTTTCAGTAAATAAAATCTG
TCCATTCCTACCTGGACATGTCCCATTAAAAAGTGGAAGATTTTAAATAATTTCTTTACA
GATGTTTTATTTAAACAGGTAGCACAATCTACTAATGTTGTGTGATTTGTGTTATACTGG
TTGTAATTAATTTTTTTAATTCATGAACTAGCGGAAAATTTATTAAATTAACTATTAACT
ACATTCACCTTGTAAATTACTGTATAAAACTTGTTGACAATGCACTGACTTTAGAAAGAT
GTTAATGTACATAAATAGAGTGTAAATAAAATAGTGTTGATGTACTGAAATATGAACTGT
ATCAAAAGTATTGGTAATTGTATATGGGGTGTACCTGTTTATCTGTTAACTATTATCCAA
ACAAATTAAATACTGTGGTTGCCTCTATGTGCTGTTTTTCCTCATACAAGTAAACACAGA
AAGTC
aaattcttcagcctccctctctgtgatcctgttttaattctcctacttgaataatttctt
tctgacttgtatacagaggggatgcttcatctctgaggttggaaactctgtagagcagga
ttccccaactcctgggctacagaccagtactgtccatggcctgttaggaaccgggctgca