Gene SMARCE1 Variant 1
DNA : 19.28 KbNT_010755
mRNA : 1576 bp NM_003079
CDS : 1236 bp NP_003070
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  76 bp
gctgggaaagtatcaaaattcggggagttttgaggatccaatgggtcctgaaaaaaatcc
ctgagtgtgctaagcatcaccgcatcttcactagaaggttagtttttctaaagagggtcg
ggtggggcccggaaaaaaaaaaaaattaagaagagtgtggaaagtgcgagtgcggaagct
CCGGACGCGAGGGGCGGGGCGAGCGCGGGACAAAGGGAAGCGAAGCCGGAGCTGCGGGCG
CTTTTTCTGCCCGCGG
gtgagtgtttccaagtgggacggaccgggtcggtgggtgcaagtcgtggtgtccccgctt
ggctagaccccgagttcccgggggttgctggggttcagccttggccgtggggccagagcc
aggagccggttgaggcctccttgaggcctagcagagcgagggttgggagggagtcccatc
EXON 2  52 bp
aatcaaccaaatgacctataagaactagttaaaatacacaaaaggcttaattactaggaa
ttaaggtgaagtaattttactcagaaataccaattaaattaccctattcattaggaaaac
attctcgtatgcttgctgagttttgattctcttttttttttccttttttttttattttag
TGTCTCAGATTCATTCTTAAGGAACTGAGAACTTAATCTTCCAAAATGTCAA
gtaagtttcaatttttatatttatcaatctatgttaataagagactaatgccctagcaag
tgggaattccaaaatactctcatttttttttcttcaaaacaggaccattggtagttttgt
tgcatagtattatatctcagttgtttacaagaagttatttattttctttcaaacagaaag
EXON 3  44 bp
tcaagtaagtttcaatttttatatttatcaatctatgttaataagagactaatgccctag
caagtgggaattccaaaatactctcatttttttttcttcaaaacaggaccattggtagtt
ttgttgcatagtattatatctcagttgtttacaagaagttatttattttctttcaaacag
AAAGACCATCTTATGCCCCACCTCCCACCCCAGCTCCTGCAACA
gtaagttttaattttcttgttaatgtaatagccaactctggccttgatacaaaaacccag
atgtcttccagtgacagtcactcaatcatcacagcaacaggatgaaattcagcttaaaag
aaaaaaaaaaaagcacttcctactaaataaaataattatttgcatctttccttgaaccaa
EXON 4  105 bp
tctcaatgaaagaaaaatatttaatttcctcagtggaaaaaaagaacaattacaacacat
cattgcttgtttaaattcaggttgcttttgcatgccatatgcagatcatttttcatttct
gtgttttcctcgtttgagctcatttctcattcgtgtttttgtctcatttgtttccatcag
CAAATGCCCAGCACACCAGGGTTTGTGGGATACAATCCATACAGTCATCTCGCCTACAAC
AACTACAGGCTGGGAGGGAACCCGGGCACCAACAGCCGGGTCACG
gtaggagaatcaactattacagcatccggcaaacaactggaattgaccagaaatgccttc
agaattaggtctttttgaatcataagcacagccatttaaaaaaaattttttaacctagct
ttttgagtattttcaacattcgttgtagcatctcacactgaaaaaataaatagtgagatc
EXON 5  81 bp
atgtgcttaaagtcattttcttttgaacatttctgaatttgcagtgatagctattttcag
tgaagaaaatatttggacgaatagaagaaaggcgcattagaattttttaagggactctct
tttcagtttgccagtgaactccttacagttgaataatgaatgtatttaactctttcgtag
GCATCCTCTGGTATCACGATTCCAAAACCCCCAAAGCCACCAGATAAGCCGCTGATGCCC
TACATGAGGTACAGCAGAAAG
gtaggtgcttaggacctggtaaggagtgaggacactgtctttgctgcttctttgcttaac
atccaactttagatcggcttagccagcttttctgtgcatattcagaggaaaggtccaaaa
aaatacggtttttaaagcaattagttctgatttcaaaattccagaactaaaatccaacaa
EXON 6  132 bp
gcaaagataacttgagattggccagttcttgataatttttgaagtaggctgatgagtacc
tagaaatttgatactgttttctctgctttgtatgttgaaaagtttccacattaaaaacta
tttttaaaggtctatacgtttagacatcagtattaacatttcatctgttttctttttaag
GTCTGGGACCAAGTAAAGGCTTCCAACCCTGACCTAAAGTTGTGGGAGATTGGCAAGATT
ATTGGTGGCATGTGGCGAGATCTCACTGATGAAGAAAAACAAGAATATTTAAACGAATAC
GAAGCAGAAAAG
gtagggtaggggctcacagtgggatagataatgtgtaaagtacataaaacattggcttac
tatttataaaagtaacataagatttggtcagaacactgatgcagtactgaggctctgtct
acctgagtcaagtcagtttctcaaggcctcagatttcttgcctgtaaaaaggagataatt
EXON 7  172 bp
ctctgtctacctgagtcaagtcagtttctcaaggcctcagatttcttgcctgtaaaaagg
agataattatcccaacaccctgtttacatcatatcttttgatattcaagtgagataacat
aggtctgcattataacctgcaaaatgttaattataaaaccaaaaaacatttgaatttcag
ATAGAGTACAATGAATCTATGAAGGCCTATCATAATTCCCCCGCGTACCTTGCTTACATA
AATGCAAAAAGTCGTGCAGAAGCTGCTTTAGAGGAAGAAAGTCGACAGAGACAATCTCGC
ATGGAGAAAGGAGAACCGTACATGAGCATTCAGCCTGCTGAAGATCCAGATG
gtaaaagaaaaaaagtggggttttgtttatgctttctctgtgagttaagatatgagaaat
ctcttaagtataagtttttatttcttatcctaaatggaaaagaaagtataatttaagtat
cgtcttagtattttggttatattgagtaagatttgtatgtgaatttcccacaagaaaaag
EXON 8  173 bp
acattacgtcctctgtatggtttttatcaagtaactgccccagtgctcccatgacgctgg
gcaggtccacttgttaggccagtgagggccatagttcgttggtaattaagtgttaacatt
gttacactcctttttatggttactggtgacctgatttccagaacaatttgttcactccag
ATTATGATGATGGCTTTTCAATGAAGCATACAGCCACCGCCCGTTTCCAGAGAAACCACC
GCCTCATCAGTGAAATTCTTAGTGAGAGTGTGGTGCCAGACGTTCGGTCAGTTGTCACAA
CAGCTAGAATGCAGGTCCTCAAACGGCAGGTCCAGTCCTTAATGGTTCATCAG
gtaaagtcataaaacattcatttcaataagatgtgcctataccacaaatcccaggtgata
tgattcctacaccatgcctaaatctacctgttaaatatgtcaatctaacctgttcctgat
ttggagaagaggtttaaggaagtggacctttcccagatgtttaataagtttgtcattaaa
EXON 9  102 bp
tctttaacatttacctattgatcataatcatttctttgtgctgcattttgtattttttaa
atcttagctagactcatgtgataaatgatctaaagttcaaaacattatttggtacactgt
ttgaaagtatggaccattaaaaaatgagacacaattatgaagcctgatcctgtcttgcag
CGAAAACTAGAAGCTGAACTTCTTCAAATAGAGGAACGACACCAGGAGAAGAAGAGGAAA
TTCCTGGAAAGCACAGATTCATTTAACAATGAACTTAAAAGG
gtatctgtttaatatgttaactatacttttatcactatacctgttactttatttttcctc
attcttttttccaaaatagtgtttttattgaatgttgttcactttgaaacagggctaact
ttattataaacctgtaggatcctttttttataagattgttcccattctctggcaaaattg
EXON 10  211 bp
agacccaagagtttcagagaagacctagaaccacatttttttggcacacacacacacaca
tacaggtgtatagatatatatatatagtttataggcaagaaaaccaacttttgaaagaat
atatctggctcaaaaattataaggaaaaaacattacggagttctgtttttttctgattag
TTGTGCGGTCTGAAAGTAGAAGTGGATATGGAGAAAATTGCAGCTGAGATTGCACAGGCA
GAGGAACAGGCCCGCAAAAGGCAGGAGGAAAGGGAGAAGGAGGCCGCAGAGCAAGCTGAG
CGCAGTCAGAGCAGCATCGTTCCTGAGGAAGAACAAGCAGCTAACAAAGGCGAGGAGAAG
AAAGACGACGAGAACATTCCGATGGAGACAG
gtaacccactagcaacaaacgcagaggcagtgccaagactttgtacggctgtctttaatt
taggtttttctttctaagtgcaagtattctggtacctgccactgagggtgattcccagta
ctaaatttgacatgatattgacattcagtattttaacctttaaatgcttacattatttat
EXON 11  428 bp
tttcatacccaaattgttccaacattcttaaaagttctttagtcacactggttcatttca
ggggtttaataaccacatgtggctagtggcttctatattggacagcacagctgtatactg
tcagcataactagagtaaaatttcatcttggaactgacagtgacaaatgtgtgattacag
AGGAGACACACCTTGAAGAAACAACAGAGAGCCAACAGAATGGTGAAGAAGGCACGTCTA
CTCCTGAGGACAAGGAGAGTGGGCAGGAGGGGGTCGACAGTATGGCAGAGGAAGGAACCA
GTGATAGTAACACTGGCTCGGAGAGCAACAGTGCAACAGTGGAGGAGCCACCAACAGATC
CCATACCAGAAGATGAGAAAAAAGAATAAGTGTTGCCTTGTTTTGTGTGTTCTAAATACT
TTTTTTAATGAAAAAATGTTTTTTGGTTTTAATGGTGTTACGTGGTTTGTGTATTAATTT
TTTTTCTTGTCCATATCACACCACCAAAGGCTTTTGGACCATTTAGCATCATGAGCCTAA
TGGCTCAGTCAGTCACCTTTCTTAAGTGTTGTGAAGATGGCTCTTTTCTTTGGATCTTGT
TTCTAGCC
ctcaactgctgaaagcctcagaatttagattaattgagaaaacacccacctcttttagag
aattatcctttgatgctgcagaatctactcttacaatgccttcctacagctcactggggt
gcttaccaaagccatagctttaaaccttcccagtccccatcagtagcttcctgaaagtct