Gene SHBG Variant 1
DNA : 3.18 KbNT_010718
mRNA : 1209 bp NM_001040
CDS : 1209 bp NP_001031
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  111 bp
gggtgatagctgagtcttgtgactgggcccctgggcaggggtcaagggtcagtgcccctg
tttcctttaccccctcctccccgggcaacctttaaccctccaccgcccacacgcaaggct
gcctgcctctacacattctcccaagagttgtctgagccgccgagtggacagtggctgatt
ATGGAGAGCAGAGGCCCACTGGCTACCTCGCGCCTGCTGCTGTTGCTGCTGTTGCTACTA
CTGCGTCACACCCGCCAGGGATGGGCCCTGAGACCTGTTCTCCCCACCCAG
gtgcaggagcgggacagggcactcagctcatgcagtcttcccttctctcctctggccctg
tagcagggcctctccctctgtctgtctctgacatgtccctactcagctttgtttgttttc
tctttctgatagagtgcccacgaccctccggctgtccacctcagcaatggcccaggacaa
EXON 2  92 bp
cgtcacacccgccagggatgggccctgagacctgttctccccacccaggtgcaggagcgg
gacagggcactcagctcatgcagtcttcccttctctcctctggccctgtagcagggcctc
tccctctgtctgtctctgacatgtccctactcagctttgtttgttttctctttctgatag
AGTGCCCACGACCCTCCGGCTGTCCACCTCAGCAATGGCCCAGGACAAGAGCCTATCGCT
GTCATGACCTTTGACCTCACCAAGATCACAAA
gtatggggttggcctagcccttgacccagtcccctggttctgccctctctccatcagctc
ttctcttttccctgtcttcctttccttatctgtgaacaccatctcccccaaacccacact
ggttctcaaaggacacatgacatacacaatctttccttctgtgtccttccagaacctcct
EXON 3  190 bp
atcacaaagtatggggttggcctagcccttgacccagtcccctggttctgccctctctcc
atcagctcttctcttttccctgtcttcctttccttatctgtgaacaccatctcccccaaa
cccacactggttctcaaaggacacatgacatacacaatctttccttctgtgtccttccag
AACCTCCTCCTCCTTTGAGGTTCGAACCTGGGACCCAGAGGGAGTGATTTTTTATGGGGA
TACCAACCCTAAGGATGACTGGTTTATGCTGGGACTTCGAGACGGCAGGCCTGAGATCCA
ACTGCACAATCACTGGGCCCAGCTTACGGTGGGTGCTGGACCACGGCTGGATGATGGGAG
ATGGCACCAG
gtaagctagctctggtcctcaggggagggatgtctggagctggtctgaggaaagggaaca
aaaccaagttattgggcatccctctaccactgtcatctcgtttaatccacacgaaccccc
acaaagtagctattcttggccccatcttttctgatgggaattctaaggctcagtcagtat
EXON 4  162 bp
ctgatgggaattctaaggctcagtcagtatataagtgacaagagctgagtgacccaaggc
caaggatgctagctgcttctttaaggcatgttctttccactatagtactaggctgcctca
caggaaggtggcagaaacagatcccaggggcctctgattttgcttcccaccttcctgcag
GTGGAAGTCAAGATGGAGGGGGACTCTGTGCTGCTGGAGGTGGATGGGGAGGAGGTGCTG
CGCCTGAGACAGGTCTCTGGGCCCCTGACCAGCAAACGCCATCCCATCATGAGGATTGCG
CTTGGGGGGCTGCTCTTCCCCGCTTCCAACCTTCGGTTGCCG
gtaactacaccccaggggtggaaccctagccaagacttggtaaagcactgctgggtggct
ggccgtgggaatctaagtccacacttttagggagaagggaagggttgagagctgcaaggg
ggaggccaaatgctcagaggggagtcaactgagggcagggaggtcgggactgcggctccg
EXON 5  160 bp
ctgctgggtggctggccgtgggaatctaagtccacacttttagggagaagggaagggttg
agagctgcaagggggaggccaaatgctcagaggggagtcaactgagggcagggaggtcgg
gactgcggctccgatgccctgatttctacatccccgtatcttatctctgtcacactccag
CTGGTTCCTGCCCTGGATGGCTGCCTGCGCCGGGATTCCTGGCTGGACAAACAGGCCGAG
ATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTAGAATCAAATCCCGGGATA
TTTCTCCCTCCAGGGACTCAGGCAGAATTCAATCTCCGAG
gtagatttcctcggagtctatttttcccaccctggccagctcagcctgcctctgtccccc
tctaccactggcccctttcctccttgagaccccagctttgaggcctcaggataatcattt
ctccccacagacattccccagcctcatgcagagccctgggccttctctttggacctggga
EXON 6  137 bp
tcccgggatatttctccctccagggactcaggcagaattcaatctccgaggtagatttcc
tcggagtctatttttcccaccctggccagctcagcctgcctctgtccccctctaccactg
gcccctttcctccttgagaccccagctttgaggcctcaggataatcatttctccccacag
ACATTCCCCAGCCTCATGCAGAGCCCTGGGCCTTCTCTTTGGACCTGGGACTCAAGCAGG
CAGCAGGCTCAGGCCACCTCCTTGCTCTTGGGACACCAGAGAACCCATCTTGGCTCAGTC
TCCACCTCCAAGATCAA
gtaaagggggacagtggggcattgcctgtattcagtggagcctggagcaatgagggaaga
ggggagtccaacatgtcaatattaggaaggtttccagcccagggaacataacaagactgg
ctccacagaattgtttttcattaataattagccaggcatggtggtgcttgcctgtaatcc
EXON 7  208 bp
gtggtttcaaaaagggtcaagccaaaaaaaattggggcaggatttaagtggtgagaatgg
ccagtaggtggaggcatagcgaagaggcagaattaaggcagctaggggtgaggccacagg
cagtaggcccggctcattcttccctctctctctaccgtccctttcccacacactctgcag
AAGGTGGTGTTGTCTTCTGGGTCGGGGCCAGGGCTGGATCTGCCCCTGGTCTTGGGACTC
CCTCTTCAGCTGAAGCTGAGTATGTCCAGGGTGGTCTTGAGCCAAGGGTCGAAGATGAAG
GCCCTTGCCCTGCCTCCCTTAGGCCTGGCTCCCCTCCTTAACCTCTGGGCCAAGCCTCAA
GGGCGTCTCTTCCTGGGGGCTTTACCAG
gtaagagagaatgatgttcaagttcatgagcacaacattggaaacagctcaagggaggcg
gcacattttgaggggaaggaaacctctgggagggaagaagaataggccacaagaagaaga
tatgggggcagtggaaggtagtgcttttgcaaactcaggttggaggagtggaaaagtggg
EXON 8  149 bp
attttgaggggaaggaaacctctgggagggaagaagaataggccacaagaagaagatatg
ggggcagtggaaggtagtgcttttgcaaactcaggttggaggagtggaaaagtggggaga
agattctggatccgagccaccttaatgctctaatgccacctttgcactacctccctctag
GAGAAGACTCTTCCACCTCTTTTTGCCTGAATGGCCTTTGGGCACAAGGTCAGAGGCTGG
ATGTGGACCAGGCCCTGAACAGAAGCCATGAGATCTGGACTCACAGCTGCCCCCAGAGCC
CAGGCAATGGCACTGACGCTTCCCATTAA
agctccacctaagaaccccctttgaaagttactgattattcatttattcaacaaatattc
actgtgcactagcaatgtaccaggcactgtgccaagtattgagttgtcttaatgagcaaa
aacactctggttcctaccctcttggtgcccacagtcccatagggaagcagacatccatca