Gene RARA Variant 1
DNA : 26.52 KbNT_010755
mRNA : 2906 bp NM_000964
CDS : 1389 bp NP_000955
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  279 bp
tctggaccttcccaggaaaagtgccagctcacagaactgcttgaccaaaggaccggctct
tgagacatcccccaacccacctggcccccagctagggtgggggctccaggagactgagat
tagcctgccctctttggacagcagctccaggacagggcgggtgggctgaccacccaaacc
CCATCTGGGCCCAGGCCCCATGCCCCGAGGAGGGGTGGTCTGAAGCCCACCAGAGCCCCC
TGCCAGACTGTCTGCCTCCCTTCTGACTGTGGCCGCTTGGCATGGCCAGCAACAGCAGCT
CCTGCCCGACACCTGGGGGCGGGCACCTCAATGGGTACCCGGTGCCTCCCTACGCCTTCT
TCTTCCCCCCTATGCTGGGTGGACTCTCCCCGCCAGGCGCTCTGACCACTCTCCAGCACC
AGCTTCCAGTTAGTGGATATAGCACACCATCCCCAGCCA
gtaagtctgggtgtgggggctggggtgggaagggactgtggagggtggcaggcctcagag
cttgggctctgggcacgtctgttctgctgtgagtggaaggcacggtgagcgacaaggtct
tctccagttggggtgaccatcatttgaggtcttaaaaatgaaagccctatggcctatagg
EXON 2  149 bp
tcattggcagcctcctgccctgagtctggctggggagtcccagttttcttaagacttgaa
tcctgccagcagtggtgaggctgggagaggctcttaggagggacggtgaggcagggtgga
gcttggtactaaggatggcgacctaggtctctaactgcccctcccctcttctctctctag
CCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCC
CTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACT
ATGGGGTCAGCGCCTGTGAGGGCTGCAAG
gtgagttgaaggggtcattgggaaggacagcttgatgaggtcaatgggatgtccccactt
ctgtgtcctgggagtgtgcagttggggggtgtccctgaagttgctgctcttctttctctg
tggaagttggcagcaagcagggacacctaccacagtttccccacaggtcctcccccataa
EXON 3  142 bp
tgaggaggatccttttaggtgaatcattctccccagcttttctggcctgctcaggtaggc
gatgggcaaacgcttgggggcagcagctggcctggccctcctcccctagactgagaccgt
agccaggcactgctcccactgtgggtgtggacaacctgactccctcccctccatacccag
GGCTTCTTCCGCCGCAGCATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAAC
TGCATCATCAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCTTT
GAAGTGGGCATGTCCAAGGAGT
gtgagtgccatagggcaggggccgagtcccgcctcagttggggtctcagatgctcctaaa
gaccaagggagcagggctctgtggatgtttgtgcacatgcatgaacacgcatgccgtggt
gtgcgggctcacggttgaggatggtttgtgtgtagctgcaaggacctgtttgcgagtctg
EXON 4  161 bp
gtgggcatggagggctggagtgcgtggcaatgccttgcctgcccgtgaacgcgtgctgtg
tgcgcgtgcttacaagcctgggtgacctcctcagcagctggcagctctctgtcaggctgg
gggtggacgaggccctgagcagcctgcagctgccctcttaaccccctctgccctccacag
CTGTGAGAAACGACCGAAACAAGAAGAAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGA
GCTACACGCTGACGCCGGAGGTGGGGGAGCTCATTGAGAAGGTGCGCAAAGCGCACCAGG
AAACCTTCCCTGCCCTCTGCCAGCTGGGCAAATACACTACG
gtatggctttcccccggcctgcagggtgggatttgcccagggccacagggccaggatggg
cccctctcaggcaccccttcttgtgccaggcaagatctctgcgtccttcccttcccctct
cttctccctcctcctgctgcctcttcccaaggagctcccaggaagtgaaggctgggtaga
EXON 5  177 bp
ttgtgccaggcaagatctctgcgtccttcccttcccctctcttctccctcctcctgctgc
ctcttcccaaggagctcccaggaagtgaaggctgggtagagggcaggcctgtgggggctg
gagccaggctgagaaggggtgccatggagaagaaggccctcactctccctcctcccccag
AACAACAGCTCAGAACAACGTGTCTCTCTGGACATTGACCTCTGGGACAAGTTCAGTGAA
CTCTCCACCAAGTGCATCATTAAGACTGTGGAGTTCGCCAAGCAGCTGCCCGGCTTCACC
ACCCTCACCATCGCCGACCAGATCACCCTCCTCAAGGCTGCCTGCCTGGACATCCTG
gtgagggtctgcaccctggcccccaggcactgcccctgtgtcctgggtagatgtccttcc
agccagacagccaccctcctaaatgtctgtctgcaatcaacctgtccaaatgcccaccgc
ccaaatgtctgcccttcctctccccatatgtccacctgtccactcgtctccctgtccact
EXON 6  205 bp
gctgaggtatggatggtgcagacgtagaacctttccatcattgtagaaaattctatcaga
cagcattgctccggccacctgccaggtggtcctccgggagtgctggtgcggagtgctggt
gccgagtgctcagagtgggttcgggttcagtccctgaacccaagcatcctctgcacccag
ATCCTGCGGATCTGCACGCGGTACACGCCCGAGCAGGACACCATGACCTTCTCGGACGGG
CTGACCCTGAACCGGACCCAGATGCACAACGCTGGCTTCGGCCCCCTCACCGACCTGGTC
TTTGCCTTCGCCAACCAGCTGCTGCCCCTGGAGATGGATGATGCGGAGACGGGGCTGCTC
AGCGCCATCTGCCTCATCTGCGGAG
gtgggcagggggcctgggtctgggggctgggctgggacgggggtgcagccctggagtctc
ttccagggagctctttcaggccacctctgttaggtatctctagagggcagggtctggtct
gcaactacacagcaagggggccatgtggggcctggactcctgttcccgatttctgggcaa
EXON 7  159 bp
gttgctcccttttaagggcctctgtaccctgcggcagcagagaccccatgccctgccctg
tgtggggaggcgcctgcgagctgccctcctccatggcctgggcaggcacgccccccggtg
gccgaggctgggggtgcagctgtgttcccagctgctcagggggtggttctgcttcctcag
ACCGCCAGGACCTGGAGCAGCCGGACCGGGTGGACATGCTGCAGGAGCCGCTGCTGGAGG
CGCTAAAGGTCTACGTGCGGAAGCGGAGGCCCAGCCGCCCCCACATGTTCCCCAAGATGC
TAATGAAGATTACTGACCTGCGAAGCATCAGCGCCAAGG
gtgaggctcacagacctggaggggtaccggcccccgacacctggcccaggcccccacatc
caagccagcaccccatgtctttgtgccaggacaatacgacacctgtccccatctgtgtct
aggctgaggtcccctagtgactccactttgccgaggtggcccgcctgtgtcacctttgtg
EXON 8  1634 bp
cattgccaccagcctctggacctgggggcttaagagagctggctcgtgtcaaagaactga
atcccaagaaagatgctaatatcagcagtattgatcttcccacctcgagccaggcttgct
ggggctgggggtgggagggctggcccagcgtgctgacctctgccccctcctttcctgcag
GGGCTGAGCGGGTGATCACGCTGAAGATGGAGATCCCGGGCTCCATGCCGCCTCTCATCC
AGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGG
GGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCA
GCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTGACCGCCCACGCCACATGGACACA
GCCCTCGCCCTCCGCCCCGGCTTTTCTCTGCCTTTCTACCGACCATGTGACCCCGCACCA
GCCCTGCCCCCACCTGCCCTCCCGGGCAGTACTGGGGACCTTCCCTGGGGGACGGGGAGG
GAGGAGGCAGCGACTCCTTGGACAGAGGCCTGGGCCCTCAGTGGACTGCCTGCTCCCACA
GCCTGGGCTGACGTCAGAGGCCGAGGCCAGGAACTGAGTGAGGCCCCTGGTCCTGGGTCT
CAGGATGGGTCCTGGGGGCCTCGTGTTCATCAAGACACCCCTCTGCCCAGCTCACCACAT
CTTCATCACCAGCAAACGCCAGGACTTGGCTCCCCCATCCTCAGAACTCACAAGCCATTG
CTCCCCAGCTGGGGAACCTCAACCTCCCCCCTGCCTCGGTTGGTGACAGAGGGGGTGGGA
CAGGGGCGGGGGGTTCCCCCTGTACATACCCTGCCATACCAACCCCAGGTATTAATTCTC
GCTGGTTTTGTTTTTATTTTAATTTTTTTGTTTTGATTTTTTTAATAAGAATTTTCATTT
TAAGCACATTTATACTGAAGGAATTTGTGCTGTGTATTGGGGGGAGCTGGATCCAGAGCT
GGAGGGGGTGGGTCCGGGGGAGGGAGTGGCTCGGAAGGGGCCCCCACTCTCCTTTCATGT
CCCTGTGCCCCCCAGTTCTCCTCCTCAGCCTTTTCCTCCTCAGTTTTCTCTTTAAAACTG
TGAAGTACTAACTTTCCAAGGCCTGCCTTCCCCTCCCTCCCACTGGAGAAGCCGCCAGCC
CCTTTCTCCCTCTGCCTGACCACTGGGTGTGGACGGTGTGGGGCAGCCCTGAAAGGACAG
GCTCCTGGCCTTGGCACTTGCCTGCACCCACCATGAGGCATGGAGCAGGGCAGAGCAAGG
GCCCCGGGACAGAGTTTTCCCAGACCTGGCTCCTCGGCAGAGCTGCCTCCCGTCAGGGCC
CACATCATCTAGGCTCCCCAGCCCCCACTGTGAAGGGGCTGGCCAGGGGCCCGAGCTGCC
CCCACCCCCGGCCTCAGCCACCAGCACCCCCATAGGGCCCCCAGACACCACACACATGCG
CGTGCGCACACACACAAACACACACACACTGGACAGTAGATGGGCCGACACACACTTGGC
CCGAGTTCCTCCATTTCCCTGGCCTGCCCCCCACCCCCAACCTGTCCCACCCCCGTGCCC
CCTCCTTACCCCGCAGGACGGGCCTACAGGGGGGTCTCCCCTCACCCCTGCACCCCCAGC
TGGGGGAGCTGGCTCTGCCCCGACCTCCTTCACCAGGGGTTGGGGCCCCTTCCCCTGGAG
CCCGTGGGTGCACCTGTTACTGTTGGGCTTTCCACTGAGATCTACTGGATAAAGAATAAA
GTTCTATTTATTCT
acacatgcctccagccttgctgcctccaccccctcctcttggcgtctggtctgggggctt
gggatgggtttcgtcatgtgctctgggcctgtgatggccaggaatgagcactggggccaa
ggggctggccagggcacccttccaagctgccttctgaggcttaccttgtgctggggtctt