Gene PSMD11 Variant 1
DNA : 36.54 KbNT_010799
mRNA : 1580 bp NM_002815
CDS : 1269 bp NP_002806
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  131 bp
ggccgcccgctaggaggcgctggggagcttgcagcccacctgcgaggcggtcccgctctc
cccacccctcagcccgcgcccggcggagagactacaactcccggagtgctctgggaacgg
agccacgggagctacaggcggagggacccgagggcgggctttccgggtgtgtgtttccgg
CGTCGGCGGCCGCGGCCGGGGACGGTGTGAGAGCGGTAAGATGGCGGCGGCGGCGGTGGT
GGAGTTCCAGAGAGCCCAGTCTCTACTCAGCACCGACCGGGAGGCCTCCATCGACATCCT
CCACTCCATCG
gtaaaggtcgccgcgccgcctccccggccccgccggcccagctcggcttatgtcggtcgg
cggcagcggagaggggcccggctagccggctctgatgctgctgactcactgtgtgagggg
ggccgggccgggggcgcaggccgctcggagctccccagagcctcccaggtctcactcttg
EXON 2  102 bp
ttctacgtatatatgatcttttttttttcctggcttagagttttttttttttttttaact
ctagaatttgtcttttggtaaatatgtttgagtttgtaatggatcttatgagggtgaaat
ttccctcagtcttcattttttggtcagaattttaagagggtttgcattttcctctcccag
TGAAGCGTGACATTCAGGAAAACGATGAAGAGGCAGTGCAAGTCAAAGAGCAGAGCATCC
TGGAACTGGGATCTCTCCTGGCAAAGACTGGACAAGCTGCAG
gtaagtgctacacatggattgtatctgaaatgctcagtgaaattcctgtcttttgttgga
gtgaagaatcatgggactgatccacaaactgaattcagctttattttcttggcaacttgt
tgagcttcagttttttagcaggcaattaagtggcctttaaactcacttctttcctggtag
EXON 3  125 bp
ttaacttatttttgctattctgctatttgctaggaatgctttaaactcctagtaagtttc
acttagactgattccagtgatgtaagtaccgatttttatgacgttgggtcagtttcttaa
gtgggtattttgtctcaaatgttgatgtttactcctctttttgaattgcctttcctacag
AGCTTGGAGGACTCCTGAAGTATGTACGACCCTTCTTGAATTCCATCAGCAAGGCTAAAG
CAGCTCGCCTGGTCCGATCTCTTCTTGATCTGTTTCTTGATATGGAAGCAGCTACAGGGC
AGGAG
gtaagtgatattaatgacagaaagtagacaatatggagaaaagtttgtttccaagaaaga
aatgcctacctgcactttagtactaatgtggaagggaaaactgggaggacagcgcaggac
ttatcatgtcagtttctctttgttacagggcatttgatactttgggtctgttccatgctt
EXON 4  72 bp
aaagccaagttgatgctccattatgatataactattacacattgagatactgtggatcag
acactaaatagagcaacatggataatatgtaaggagggaatttaagctgttctccaaagc
atggtttgtgggaagaatttgaggacataatgttgcatgtactgtctctccttattgcag
GTCGAGCTGTGTTTAGAGTGCATCGAATGGGCCAAGTCAGAGAAAAGAACTTTCTTACGC
CAAGCTTTGGAG
gtaggttttacattagtactcatttcaggtctctaagcatgagacagagggtgaatgtaa
gcagtaccatccttatcaaaagtatcttcagcaactttgtaattacctagataccgaaag
attattgatggtagccccacttatgataattgctctgattgaagttttgagacagatttg
EXON 5  58 bp
aacagtcatttgctggctataataggagacaatacattggctagatcgtctcttatgctg
aatttgatgctatcatcagaaattgcatatttaacagtaacagttctgtgactgtcaatc
tttgatttctttctgtggctttttccccccccttcaatcaatgccttttctctttcctag
GCAAGACTGGTGTCTTTGTACTTTGATACCAAGAGGTACCAGGAAGCATTGCATTTGG
gtaagtaagctggtaataagtcatctcagctagctaaatgaatgtattctaaaccacctg
gctactcttactaattacctgttaataatttatattctactgacttctaagaaggattta
aagtagcttacagttctgcatttgtcatgggaaaatgtcatttgaaagtttaaaaaacta
EXON 6  195 bp
ctcttggaagatagcacattagtggaaaatttaattattgcatggggtctagaggtaacc
ttttttgagttcaggaatttttttttttttttaatcctgagtgttatgagggtgggagag
tgagctattattaggtattaagctgatggctataaaggagaatgtcttttcctttttcag
GTTCTCAGCTGCTGCGGGAGTTGAAAAAGATGGACGACAAAGCTCTTTTGGTGGAAGTAC
AGCTTTTAGAAAGCAAAACATACCATGCCCTGAGCAACCTGCCGAAAGCCCGAGCTGCCT
TAACTTCTGCTCGAACCACAGCAAATGCCATCTACTGCCCCCCTAAATTGCAGGCCACCT
TGGACATGCAGTCGG
gtaacagacgtagctattcctgggatgtgttttcttaaagctcatcttattttataggtg
gaaggaatgggggttggggctggagaataaaattggctgatttggctctagcttcttcag
agaaccagttagaaagctacctttctaactagctgctcccctcctgttaactgcctaaaa
EXON 7  145 bp
ctcaggcttgtctcgaactcctgggctcacatgatcctcccatctcagcctcccaaagtg
tggatttacaggtgtgagccaccgtgcccatttaggtagatgtctaagctgcctcccagc
tctgatcttttatggctctattattttatatgttcttattcctttcttttcaatgcccag
GTATTATCCATGCAGCAGAAGAGAAGGACTGGAAAACTGCGTACTCATACTTCTATGAGG
CATTTGAGGGTTATGACTCCATCGACAGCCCCAAGGCCATCACATCTCTGAAGTACATGT
TGCTGTGCAAAATCATGCTCAACAC
gtaggtgcaccttaactctggactacaagaactcagatccttcagcaagtctgtttgcca
tggcagagatggcctgagcagggagtttggccagttacagaaacagcagcagctgcggcc
tctagggctggctaaggtagagcgggaggatcaaaagtggtccagaaaactttcgcttgc
EXON 8  61 bp
cagagtggagaaaacctagcttttgcaatgtgatgggcatatgggtttaggggttgggct
gattgtctgtgtgggcagagtctttattacaatggaattctgttaaaaagaaatttgccc
aaaccttcctttagaagcataacatctgcagcaattgaccaagtatgtctttttttctag
CCCAGAAGATGTCCAGGCTTTGGTGAGCGGGAAGCTTGCACTTCGGTATGCAGGGAGGCA
G
gtagggactcccttgactgcagttctgctcactctgagaccagcatgttttcagagtcac
aacgtttgatgagaccagcactcttcagatcttcatactactctcttccttctgccccac
tcacttccttcccttaagcccattcagtgtgtttcccagactgttaaattcttggcctgg
EXON 9  63 bp
ggcatatagtggtattcagtacttgcggctcttcttcccgggcgtctgaagaagaacgat
ggtggggcgggttcttccttttggcagaagttgtgtggacacagcatactgcttatgaga
cttgggtaaatgttagtgtgcagaataaatcgctttcatggtttgtctctttattctcag
ACAGAAGCATTAAAATGCGTGGCTCAGGCTAGCAAGAACAGATCACTGGCAGATTTTGAA
AAG
gtgagtatgatattgggttggtatggaatgtgagtggaagagagggacgtttaagtactt
caaaacacacttttaaaaataattatagtttcaaaagaagttgcaaatgattccatgtat
ccttcacctaggacagtattaaaaccaggaaatagttaagcactttgtacaatgaaactt
EXON 10  126 bp
aacttccctttcagttcttgacattccttttctgctttgtatcatgcatctccccagatc
tcccctaacttcattcaaccatgtagttttataagggccagcagactatctaggaagcag
gagtagcatgactttaaagtgattctctgtgccaatctctgcaactggttcctttggcag
GCTCTGACAGATTACCGGGCAGAGCTCCGGGATGACCCAATCATCAGCACACACTTGGCC
AAGTTGTATGATAACTTACTAGAACAGAATCTGATCCGAGTCATTGAGCCTTTTTCCAGA
GTACAG
gtgagaaccctctggggactccatttctggccaggcattctcactgtagccacctccctt
ccacacctgtccagaatgggaactcacttctaggggtgtgcctggtgggcaagaggccac
caagagcttgggcctctgttgataaaatgaacaaaaatcgaggagagagatgctgtgggt
EXON 11  36 bp
ttgtgtgtagcagtgaagggcaggcagatgggcagagaacaagagacttaagcacggcca
aggagggtcttacattagaattttgagaaatacagcagttctccccctgttccctccctt
ctcttattggaggcaaaagtaaaactttcagtgttggtgtctctctgcctttccttttag
ATTGAACACATATCTAGTCTCATCAAACTCTCCAAG
gtaaggagtcttaaggccatctgcagggaggaatgggacggggtggcgaggaggggtggc
acatgcacctgattggcctcattggaaagctccccagcttctcagtggggaatgggcagt
gtggactagagtaggagttgcattgttgctattttgttttcagtccatttggcctaagac
EXON 12  52 bp
cattggaaagctccccagcttctcagtggggaatgggcagtgtggactagagtaggagtt
gcattgttgctattttgttttcagtccatttggcctaagacccctccaacaaagctactg
tgtcagggtgatctctgactagtggatactggtccctttaatcatgtgctttgattttag
GCCGACGTGGAAAGGAAATTATCACAGATGATTCTTGACAAGAAATTTCATG
gtaagtaacagtcacacaggcaagggggctggtggtggtgatgagatggttgaagaagtt
tattttcaaagaagatgttctatttgtttcccccgatggttcaccctggggtcctggccc
ctcttccctgtgatgagaatgtgtaataagcatgtgtacatggaatagggagatgaattc
EXON 13  143 bp
tcctggcccctcttccctgtgatgagaatgtgtaataagcatgtgtacatggaataggga
gatgaattctatttcccttcttttctggacacagtgagtcaactagggagtgggctgctt
cacaaacacttttgtgtctaacctcatcttttacctgggttgcccttgtgtttcttgcag
GGATTTTGGACCAGGGGGAGGGTGTCCTGATTATTTTCGATGAACCCCCAGTAGATAAAA
CTTACGAAGCTGCTCTGGAAACAATTCAGAACATGAGCAAAGTAGTGGATTCCCTCTACA
ACAAAGCCAAGAAACTGACATAG
gtgagtgctggcttcaggaccccagggctgggcagctctgtcttctgcgtgtcgagactg
aaaacctcctcctggtgtcctcatggcttcctgattgacactgctctgtcttctcttgca
gagttggatctgtagcggtcctttggagagtgtgtgtggcgggagagtgaaaccttgggg
EXON 14  271 bp
ttcagaacatgagcaaagtagtggattccctctacaacaaagccaagaaactgacatagg
tgagtgctggcttcaggaccccagggctgggcagctctgtcttctgcgtgtcgagactga
aaacctcctcctggtgtcctcatggcttcctgattgacactgctctgtcttctcttgcag
AGTTGGATCTGTAGCGGTCCTTTGGAGAGTGTGTGTGGCGGGAGAGTGAAACCTTGGGGG
AAAATGCTAGGAGATTCTTTTTTCTTTTTGTTCTACTTTTCGCTCGGAAAGTTTTTAAAT
CCTCATTTGGTGCATCTGTATTCCAGCCAATAGGTGTGCCAGTTTTCATGTAATCTTTAC
TGGCCCAACTTGGGAGTGGGGAAATTGCTTAAAAAAAAAGAAAAAGAAAAAAAAAAAGAT
TATTCTAAATAAAAGGAAAAAGGCTTACACT
acctaaagctgtgctctctgcctcctgggagagggccgcaaagccaggcaccccgccaac
cactgggggtcctaatccacctgctgggcatcacctctcctcctcctcagaattgggtgt
ttgctgaccatcaaaagcaatgactttttattctgtttgtactgaaccaaaacaaacaac