Gene PRKCA Variant 1
DNA : 501.41 KbNT_010783
mRNA : 2243 bp NM_002737
CDS : 2019 bp NP_002728
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  196 bp
tccggctcccgctcccgctccgcgcagcaccagcccgactctccccggcccccgccgcgc
cccctcgccgcgacctcggccaccggcccgcgccccgcgcccggggtcgccccgagcccg
cacctctcccccgccgcccccgcccacccggccctccgcggccgcagctccccggcggag
GCAAGAGGTGGTTGGGGGGGACCATGGCTGACGTTTTCCCGGGCAACGACTCCACGGCGT
CTCAGGACGTGGCCAACCGCTTCGCCCGCAAAGGGGCGCTGAGGCAGAAGAACGTGCACG
AGGTGAAGGACCACAAATTCATCGCGCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACT
GCACCGACTTCATCTG
gtaggtgccgggccgggcactcctgccccgctcctccccgcctccgggtcccggcacccg
gcgctccggcgcgtccgccccggggctggctcactccgataacttggaaccggcgggagt
ccgaactcttcgcccggagtgacacgcgcgcccggccctgacaccggcgggcaggactcc
EXON 2  32 bp
ccccaaggttgaatttacacagtaatctgactagatatttaggtatgtttttttctatta
aatcattgggtttcacatacaaacctttagtggtagagtacttggtcacataacttgttt
aaaatatgctatccaacagaaaatatgttaagatattttgttcttgtttttgtttttcag
GGGGTTTGGGAAACAAGGCTTCCAGTGCCAAG
gtaagctaccacttttggttttattttcaagcacaacatgaaataagcattccaaacaag
aacattatttccagtcatattttctttccaataaaaaaatgttatttagataattttgaa
atatgagggctgtaaatttgggccttaaaaaataattggggcctactaatctgcatatag
EXON 3  83 bp
agtctaatcaataccaaatgttgctgattctagaatgaaatgccttctgattgctgttta
taagattctgtctgtagtgaaattaaattgacttctaacagcaagtatctctgtttggaa
aataaagctcgtatgttaaatcatgtctattctaattttagtttcctttttctctaccag
TTTGCTGTTTTGTGGTCCACAAGAGGTGCCATGAATTTGTTACTTTTTCTTGTCCGGGTG
CGGATAAGGGACCCGACACTGAT
gtaagtagtcctgaaatcatgatttgatgtcaatgtggatttctgagctttaattttttt
aacgcctgtgcaactgttagttttggcacttactgttaatgggaagactcaattctcata
gagcgttggcttgtagtaatgagcagatttatagcccatatgagctctggactacatctt
EXON 4  112 bp
tctaaaatatttagtggcgaagtcaccaccacccattgtgtgactccagagaatgatgca
cagtctggtgttatcgaaccttgacttggggctggggagtggtggggcctgagcttggct
taatctaaaaacgtggtcctttcatgactaaaatgagcattgtgcttcttctcctcccag
GACCCCAGGAGCAAGCACAAGTTCAAAATCCACACTTACGGAAGCCCCACCTTCTGCGAT
CACTGTGGGTCACTGCTCTATGGACTTATCCATCAAGGGATGAAATGTGACA
gtaagtaagttttcttttccagttcatagcgaggctctgtagctcatgctcagggtttgc
tgagcaaggaaggctcagtaacttttcaacaccaactcttcagtagagggaattagttca
gatatctaccagactgacaaagtgtagattcttccactgtcaaagttccaggttattgaa
EXON 5  129 bp
tcacatgaagcctgtgctgtacaggacatctgctaacagttctttatgtcaccaaaaaca
ttatagcaaagtatcgagttgggggtaactcattttcacttgtgctcatgcaccaaaaca
ctgaggagcggtggttggagtccatatgcccagctcaccctctcctttcttgattcacag
CCTGCGATATGAACGTTCACAAGCAATGCGTCATCAATGTCCCCAGCCTCTGCGGAATGG
ATCACACTGAGAAGAGGGGGCGGATTTACCTAAAGGCTGAGGTTGCTGATGAAAAGCTCC
ATGTCACAG
gtaaggcttgctcatcccggagcagcatcgtgggcaggcatttggatgaaggttacactg
atattaaggcagggtgggggctgggctggatgccctgaggcctctggagaggcagtcgcc
ctggtggagccatcactgtctcagagccctccagccctctgagccctcgggttaatacac
EXON 6  157 bp
gccggtggtggcagcgggtagcttttctcatgtcgagtgttagaggcttttggcttccac
catctgtctccttaaacgccattctgacgtctcttttattcagcttggtattgacacaag
acagcgggcaatataggtctgttctctttttgtaatattttcttccttctctcttcacag
TACGAGATGCAAAAAATCTAATCCCTATGGATCCAAACGGGCTTTCAGATCCTTATGTGA
AGCTGAAACTTATTCCTGATCCCAAGAATGAAAGCAAGCAAAAAACCAAAACCATCCGCT
CCACACTAAATCCGCAGTGGAATGAGTCCTTTACATT
gtaagtggtctctccttgatcaaatttcattcctatacaccatgcagttgcccacctcat
tatttgaggtaatgaagtaggttcattataaacgtctttaaacatgtcttcagtcctaag
acctcctcaggctgccattagggaggtagctattagcacctgttcgatagatagtaattt
EXON 7  135 bp
ggtcatagtttgttaactcctgtagcgctttgcttgccagcataaggggttggtatttta
ctggaccaggaagacaaatatactatttctttatctcaggctcgagtcatatacatgtgg
tatctcccaagaaaccatgatcaagataacctagtgtttgcatgtgtgtgtgtcttgtag
CAAATTGAAACCTTCAGACAAAGACCGACGACTGTCTGTAGAAATCTGGGACTGGGATCG
AACAACAAGGAATGACTTCATGGGATCCCTTTCCTTTGGAGTTTCGGAGCTGATGAAGAT
GCCGGCCAGTGGATG
gtatggaagccgcttaggttgagtatgtctcaaagcatcagaccatttagacagttaggt
ttcagtctctcaaatgtcagttgaggctggacatggtgcctcatgcttgtaatcccagca
cttcaagaggccgaggcaggtggattgcttgagctctgaggtttgagaccagcctgggca
EXON 8  97 bp
ccagcctgcacaacagagctaccctgtctcaaaaatataaaaatgtaaaaaaagtcaaat
gtctactgatctggctgtagcctctccgtaggatgcgtttcacaaaaccgctcgactaga
ggctgcaggaaaggcttgttaaacttgcggtggtaactcttcttctcccgtccttgaaag
GTACAAGTTGCTTAACCAAGAAGAAGGTGAGTACTACAACGTACCCATTCCGGAAGGGGA
CGAGGAAGGAAACATGGAACTCAGGCAGAAATTCGAG
gtgaggataacaaaatgcccggaaacacctttcctttagaaagcccaacttcaggaacgg
ccgagatgttgtggtcacatttttgaaaagcaaaaaaaaagtaatctcaatgttaatgat
ctttttctttatttaaaaacatgaatgttgttcgttccctttcctttgcaagctgttgac
EXON 9  138 bp
ccctgtagggtgagtgtagctgctgatatctgaacaggtactcaattctcaccctttgtt
ccttttctcaccccatcccacctccaagcaaacattaaactcagttacaacacggtggtt
tctgtcactctttccccagaaaaatgacccacgtgtttcccatttgtgcttgttatttag
AAAGCCAAACTTGGCCCTGCTGGCAACAAAGTCATCAGTCCCTCTGAAGACAGGAAACAA
CCTTCCAACAACCTTGACCGAGTGAAACTCACGGACTTCAATTTCCTCATGGTGTTGGGA
AAGGGGAGTTTTGGAAAG
gtaagaggacagtcgtctgcaaattgcaggggcttctgcagagaatgtcgaatcagtttt
gttctcctcgtagtttgcagaatagcacattagatttccctgtgattcaaggtcaggaga
tcaagaccatcctggctaacacggtgaagccccatctctactaaaaatacaaaaaattag
EXON 10  174 bp
gactgaatttgtagtgatgtgtagaatttacaaatttgcacataaagtttaatattttta
tgttccacattgacaaaggtgcacaaactgtcactgagccgtcacctggcctggttcctt
ccctctgccccccaagatatgtgcttacaagtgttcaggttgttcttgacgtgttctcag
GTGATGCTTGCCGACAGGAAGGGCACAGAAGAACTGTATGCAATCAAAATCCTGAAGAAG
GATGTGGTGATTCAGGATGATGACGTGGAGTGCACCATGGTAGAAAAGCGAGTCTTGGCC
CTGCTTGACAAACCCCCGTTCTTGACGCAGCTGCACTCCTGCTTCCAGACAGTG
gtaaggaccctgggaatccctgcgatgcagtacccagctctcagagctacgcctcagccc
aaagcttcttagcatccttgttcctttggagaaggctggagaaaggtgtgttgtgatgtc
aagcagaggtgactggggaccacctcccacctctctcactggtagatttggggcatgcct
EXON 11  92 bp
cagtagggtttattacttattctttctttggaaaaaaatgtgaaagagctctaaactgag
cacatctgcccatgcagtccccatttaactaatgagaaagcaaaacacaacctgtgaaga
gcaaaggaagccacttggctggggaggagccctgctcatgtgttgaaccttggtctgcag
GATCGGCTGTACTTCGTCATGGAATATGTCAACGGTGGGGACCTCATGTACCACATTCAG
CAAGTAGGAAAATTTAAGGAACCACAAGCAGT
gtgagtattattttttaagtcctttaatttgaacaaccaagtcctaccaactggaaactt
ccttttttcccccccgcttgagattgggggtctcactctgtcactcaggctttgcctccc
aggctcgggtgattctcccacctcagcctcctgagtagctgggactacaggcacacacca
EXON 12  63 bp
gataagctggaggacgaagtgatggagggaggaccgggggttggaagaacacgatgctgg
tctctgagagcctctgggtctgacattcttttctctctttgatgcttgaatttgagaatg
taaagtatacaggcatctaaggaagcaagtgagaaacctgaagcccgttttcttttgcag
ATTCTATGCGGCAGAGATTTCCATCGGATTGTTCTTTCTTCATAAAAGAGGAATCATTTA
TAG
gtgtgtattgaagccctcctaccagcagctcagcagagaggttagctgggcctctgtggg
catgtcattctggaatggtgacttaagacacagagttgataactccccaggaggaacaga
gacctgctgggacccaccttcctcctcaccctggaggcaaatcagagccaccttctgatt
EXON 13  139 bp
cacaatattagtctctgaagatatcaacacacattgacttctgatactacagtccaggga
cttatagttaatattgccattgagctgacaggtattcagatatccttctatttcaccagt
tccaaagcaaaccatgttatgtcatgggaaggactctgatgttaacccggttccttgcag
GGATCTGAAGTTAGATAACGTCATGTTGGATTCAGAAGGACATATCAAAATTGCTGACTT
TGGGATGTGCAAGGAACACATGATGGATGGAGTCACGACCAGGACCTTCTGTGGGACTCC
AGATTATATCGCCCCAGAG
gtaggaaccccagtgatcgttttctcaaccaggactcccaaactgtaaacgcagccctct
catgggttatagggtcactggcgaatcatgaagtcagtgcatggtcacagccactaaatg
gactaaactggacaaaacagactaaaatagaggaaataggagagcccattgcacatagta
EXON 14  81 bp
gatagttctccgtgtgtctgatttgaagggtcctcttcccttggcgtaacatcaaagaca
gatcttagcacctcatctgcatgaactgagtgtataaatgcctacctgcttgacttacct
gttctgacaggggctattggacttaccactaatgtaattgatgtgtttgttttcacacag
ATAATCGCTTATCAGCCGTATGGAAAATCTGTGGACTGGTGGGCCTATGGCGTCCTGTTG
TATGAAATGCTTGCCGGGCAG
gtaatgttttgctacattttcatgtttgtttattgctgtgttatgtgaatacttcagctc
tggttgggcctcgagagcaagacctgacgttttagtgcagctggtgttggcgtgacttcc
ctgacccaggcgaaagagggagaaacgcccccttcaaagtggatcacgttcagtatgcac
EXON 15  108 bp
aaccgtcaatctcattaaagatgatcaaataaaccgtcaagttagctgagcaaactgtgc
agcctgtggtggggctgagaaacctggtctgttccttggtgctgaattggctcttcaggc
accatgtgaatgaattactctgcctaaatactttcccatctttctttttttccggaacag
CCTCCATTTGATGGTGAAGATGAAGACGAGCTATTTCAGTCTATCATGGAGCACAACGTT
TCCTATCCAAAATCCTTGTCCAAGGAGGCTGTTTCTGTCTGCAAAGGA
gtaagtcgatttggataccttttgtgatcatggaccaagagctttggtaggagaaatact
ttccccacacttctaagagagatggcagaaacaccacaaacccacaccactgcattttgg
ccatcgagggttggggcttggtgtcatgccccaagataaccagcaccccaactttggaca
EXON 16  141 bp
tgtcatttttgtgagttggcttcacttcgtacaagccactgagtgtcttggtcagctctc
tgagatgctgtccaggcgtccacaaagtcagggctgtaggcagagctaggcaaatggaag
gtgctgtctgtgggaagcccttgacatccattgttctccttttctccttttcctttctag
CTGATGACCAAACACCCAGCCAAGCGGCTGGGCTGTGGGCCTGAGGGGGAGAGGGACGTG
AGAGAGCATGCCTTCTTCCGGAGGATCGACTGGGAAAAACTGGAGAACAGGGAGATCCAG
CCACCATTCAAGCCCAAAGTG
gtgagtccagaaaagcagcctgttttcggaaccccatgtccccaaattctgggagtatcc
cactcacctcttttcttggagagaggaggccggtgcccctggcttgtacagggtgaggaa
acgggccaggtttcagccttgtcctcagtcctgtggcctcagcagccgggattcctgctg
EXON 17  366 bp
gttgttgtctgctgtgcctggcttttcaatccaataggcctgcaagtcctccgagattcc
tcctcctaaccagcccggagttccccagggccgtgcccctccccagagagggccctcgga
gagctgctcccgcattgtcatgttgactgacctttccttctttttgtcttttctccacag
TGTGGCAAAGGAGCAGAGAACTTTGACAAGTTCTTCACACGAGGACAGCCCGTCTTAACA
CCACCTGATCAGCTGGTTATTGCTAACATAGACCAGTCTGATTTTGAAGGGTTCTCGTAT
GTCAACCCCCAGTTTGTGCACCCCATCTTACAGAGTGCAGTATGAAACTCACCAGCGAGA
ACAAACACCTCCCCAGCCCCCAGCCCTCCCCGCAGTGGGAAGTGAATCCTTAACCCTAAA
ATTTTAAGGCCACGGCCTTGTGTCTGATTCCATATGGAGGCCTGAAAATTGTAGGGTTAT
TAGTCCAAATGTGATCAACTGTTCAGGGTCTCTCTCTTACAACCAAGAACATTATCTTAG
TGGAAG
atggtacgtcatgctcagtgtccagtttaattctgtagaagttacgtctggctctaggtt
aacccttcctagaaagcaagcagactgttgccccattttgggtacaatttgatatacttt
ccataccctccatctgtggatttttcagcattggaatcccccaaccagagatgttaaagt