Gene PNMT Variant 1
DNA : 2.22 KbNT_010755
mRNA : 1157 bp NM_002686
CDS : 849 bp NP_002677
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  424 bp
aatggctgcggggggctggagaagagagatgggaggggccggccggcgggggtgaggggg
tctaaagattgtgggggtgaggaactgagggtggggggcgcccagaggcgggactcgggg
cggggcaggcgaggcggagggcgagggctgcgggagcaagtacggagccgggggtgtggg
GGACGATTGCCGCTGCAGCCGCCGCCCCACTCACCTCCGGTGTGTCTGCAGCCCGGACAC
TAAGGGAGATGGATGAATGGGTGGGGAGGATGCGGCGCACATGGCCCCGGGCGGCTCGGC
GGTCAGCTGCCGCCCCCACAGCGGACCGGTCGGGGCGGGGGTCGGGCGGTAGAAAAAAGG
GCCGCGAGGCGAGCGGGGCACTGGGCGGACCGCGGCGGCAGCATGAGCGGCGCAGACCGT
AGCCCCAATGCGGGCGCAGCCCCTGACTCGGCCCCGGGCCAGGCGGCGGTGGCTTCGGCC
TACCAGCGCTTCGAGCCGCGCGCCTACCTCCGCAACAACTACGCGCCCCCTCGCGGGGAC
CTGTGCAACCCGAACGGCGTCGGGCCGTGGAAGCTGCGCTGCTTGGCGCAGACCTTCGCC
ACCG
gtgagcgggggaaactgaggcacgagggacaagaggtcgtcggggagtgaaagcaggcgc
agggaaataaaaagaaggaaagggagacagaccaggcgcctaacagatggggaccaagaa
acaagagatagctgagaggtgcaaacagaagagaaaaaagagcaacatcccttaggagag
EXON 2  208 bp
ccatgttggagctgggttcagtctaactctggggccaatgctttttccagatggagacac
atttgcagaggagaaggaagaactagagagaggcagggagatgcaggggagggaagggta
aggaggcaggggctgcctgggctggctggcaccaggaccctcttcctctgccctgcccag
GTGAAGTGTCCGGACGCACCCTCATCGACATTGGTTCAGGCCCCACCGTGTACCAGCTGC
TCAGTGCCTGCAGCCACTTTGAGGACATCACCATGACAGATTTCCTGGAGGTCAACCGCC
AGGAGCTGGGGCGCTGGCTGCAGGAGGAGCCGGGGGCCTTCAACTGGAGCATGTACAGCC
AACATGCCTGCCTCATTGAGGGCAAGGG
gtaaggactggggggtgagggttggggaggaggcttcccatagagtggctggttggggca
acagaggcctgagcgtagaacagccttgagccctgccttgtgcctcctgcacagggaatg
ctggcaggataaggagcgccagctgcgagccagggtgaaacgggtcctgcccatcgacgt
EXON 3  525 bp
ggaggagccgggggccttcaactggagcatgtacagccaacatgcctgcctcattgaggg
caaggggtaaggactggggggtgagggttggggaggaggcttcccatagagtggctggtt
ggggcaacagaggcctgagcgtagaacagccttgagccctgccttgtgcctcctgcacag
GGAATGCTGGCAGGATAAGGAGCGCCAGCTGCGAGCCAGGGTGAAACGGGTCCTGCCCAT
CGACGTGCACCAGCCCCAGCCCCTGGGTGCTGGGAGCCCAGCTCCCCTGCCTGCTGACGC
CCTGGTCTCTGCCTTCTGCTTGGAGGCTGTGAGCCCAGATCTTGCCAGCTTTCAGCGGGC
CCTGGACCACATCACCACGCTGCTGAGGCCTGGGGGGCACCTCCTCCTCATCGGGGCCCT
GGAGGAGTCGTGGTACCTGGCTGGGGAGGCCAGGCTGACGGTGGTGCCAGTGTCTGAGGA
GGAGGTGAGGGAGGCCCTGGTGCGTAGTGGCTACAAGGTCCGGGACCTCCGCACCTATAT
CATGCCTGCCCACCTTCAGACAGGCGTAGATGATGTCAAGGGCGTCTTCTTCGCCTGGGC
TCAGAAGGTTGGGCTGTGAGGGCTGTACCTGGTGCCCTGTGGCCCCCACCCACCTGGATT
CCCTGTTCTTTGAAGTGGCACCTAATAAAGAAATAATACCCTGCC
gctgcggtcagtgctgtgtgtggctctcctgggaagcagcaagggcccagagatctgagt
gtccgggtaggggagacattcaccctaggctttttttccagaagcttccttgaggctagc
attctgtaccactcattcttcccaaactaaggaaggccaaggtcaggggagctcaccggg