Gene NUP88 Variant 1
DNA : 33.58 KbNT_010718
mRNA : 2358 bp NM_002532
CDS : 2226 bp NP_002523
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  323 bp
ttcagaaataatggtgattggctttcccttggtgacgcccctgcttggtgggctggcctc
gccttcgccccccgacctggcacgagcctctcgagcttccgggccgtctgctcggtgatt
ggccgaaacagtgagtggacggccgcggattggctgtgctcagcggcgggctgagcaact
GGAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGCCGCCGAGGGACCGGTGGGCGACGGCG
AGCTGTGGCAGACCTGGCTTCCTAACCACGTCGTGTTCTTGCGGCTCCGGGAGGGACTGA
AAAACCAGAGTCCAACCGAAGCTGAGAAACCAGCTTCTTCGTCGTTGCCTTCGTCGCCGC
CGCCGCAGTTGCTGACGAGAAACGTGGTCTTTGGCCTCGGCGGAGAGCTTTTCCTGTGGG
ACGGAGAAGACAGCTCCTTCTTAGTCGTTCGCCTTCGGGGCCCCAGCGGCGGCGGCGAAG
AGCCCGCCCTGTCCCAGTACCAG
gtaatgccaggccgatcttggaagtgaccctcaccgggatcggaaccagtcttttttgtt
ccttgctcctcttggctgtttttcatcttgtggcaggcgttccagcggattgactccgac
gctgccatacgcggtcgcggggactcaggctctctcgatgcttacggcctggaggcctgg
EXON 2  170 bp
aagactctgtctcaaaaaaaaaaaaaaaaatttgtgagttaatggtacaagtgtgagtac
ttatccagagttttattatcctataattgtagtaaactaagtattactgtgatttcaagt
aactgccacctatatttaaattaaaattaactatgttgactggtttgctctaattttcag
AGATTGCTTTGCATAAATCCACCCCTGTTTGAAATCTATCAAGTCTTGTTAAGCCCAACA
CAACATCATGTAGCACTTATAGGAATAAAAGGACTTATGGTATTAGAATTACCTAAAAGA
TGGGGGAAGAATTCTGAATTTGAAGGTGGAAAATCAACAGTGAATTGTAG
gtaagttgtatactatttatctgtataatttattatatatacagaaaattgttcaagact
agtggttcttaagcatgtttagtatactactcttaaaacattaaaacactcctcgtggtc
tgcagactggcttctgtgttatcaatgttcatagtatatgtgtaattgattgtactttat
EXON 3  126 bp
ctgaggcaggagaatcacttgaacctgggaggcggaggttgcagtgagccgagattgtgc
cgttacactccagcctgggcaacaagagagaaactccatctgcaaaaaaaagaagttcct
ttagaagattttcatccaagttgtacaaaatgttttggaaaattattatctttattttag
TACCACTCCAGTTGCGGAGAGATTTTTCACCAGTTCCACCTCTCTGACTCTAAAGCATGC
TGCATGGTATCCAAGTGAAATCCTGGATCCCCACGTAGTGCTGTTAACATCAGACAACGT
AATCAG
gtaaattttatttctctctcttgaagccttgcgagtgggaaagctctgtttctgtttgcc
aattaacagctcaacatagaacgaagtgagtcattgaatgagtcagtgcttttattggat
ggctgttgtaacccattctcaatcataagaattgcctaactgctctaacttaccactatt
EXON 4  87 bp
ccttatgtagttaaagaataaatgaactagactactttgcaacagcaagatttttgcaaa
gaaatagttgtgataagtgttagaaaattctcaagaactgactagatggagaggaaagtg
cagttttgggaaatgaaaacagaattttaagtgctggttttcttctcttttggttgctag
AATTTACTCACTACGTGAGCCGCAGACACCCACTAACGTGATAATACTTTCAGAAGCCGA
AGAGGAAAGTCTAGTACTCAATAAAGG
gtaagtttttatttgagtcttgaaatggttttttaattagcttattgggattataaatgc
aattttaacaggttgcaaggtttttcagaggtgactagcatgcttttggtaatgtgagaa
gtaagtgtatttttagtagaacagggattcgtcgtgttggccaggctggtctggaactcc
EXON 5  177 bp
gaatttttaaatgttaacattcttcataatcattttttgtcttttcagtccattgcctac
aaattccatacatacccacctcctgttattagacattttgtgtttttgttttgttttgtt
tttctttttactttttgttgtttttgtttttaacaagttggtttttacatctctttccag
AAGGGCGTATACCGCATCTCTAGGAGAGACAGCAGTTGCATTTGACTTTGGGCCATTGGC
AGCAGTCCCAAAGACTCTATTTGGACAAAACGGCAAAGATGAAGTAGTGGCATACCCACT
GTACATCTTATATGAAAATGGAGAGACTTTCCTGACATACATCAGTCTGTTACACAG
gtaagttgaggtggtcacccacctgaaatgaaaactcagtttgggctccagtagatatca
ttgaggctggacttgggagccatgtttttgagtctgtggaaatgttgcagccttcacatg
cttggcttgcatatttttgagaaagagttagtacaggtcatttggcctttcatttcttca
EXON 6  187 bp
ggttgagaaacacagagtggtgggatctgagtgggaaagcgagaagatggagtattggga
atacactacatttataatgaaggtatgatagctggaggaaaacaaagtcaaagaatggtt
ttatgggatgagcatgcatactgtcaacatttcccaaatatgtttttactccttctttag
CCCTGGAAATATTGGAAAGCTGTTGGGTCCATTGCCCATGCATCCTGCGGCTGAAGATAA
CTATGGTTATGATGCGTGTGCTGTACTCTGCTTACCCTGTGTCCCCAATATCTTAGTGAT
CGCTACTGAATCAGGAATGCTGTATCACTGTGTCGTGCTAGAAGGGGAAGAAGAAGATGA
CCACACG
gtaagtgcaggctgctgtggttgtttgtatcttcaacacctggcatagttcctgacccaa
tatgaatgcttaatatatgagaaggaattttaacttacttatggaacttctgatattttg
gaaattaaacagttaaaaaagtagctgaagcacacttagcagtctaagtggaaagaagtt
EXON 7  148 bp
tggccaggctggtctcgaactcctgacctcagatgatccacctgcctcggcctcccaaag
tgctgggattacaggcaagaacagccgcacccggccctgacccagctttttgcctgtttt
taattgtgtacattttcaaattaacatgcaagatcaaaattacaacacttttttttacag
TCAGAAAAGTCCTGGGATTCCAGGATTGACCTCATTCCTTCTCTGTATGTGTTTGAATGT
GTTGAGTTGGAGCTTGCTTTGAAACTGGCATCTGGAGAGGATGACCCTTTTGATTCTGAC
TTTTCTTGTCCAGTCAAACTTCATAGAG
gtaagctcttcaataaatgtagtgcttttttcccatgatttttatactaagactatcata
gactgttcctatgtaatgtatttgttctgtggttccagcctttaaaaagttgactgggtt
ttttttagctttttagtcactatagtacactttttgtctaaggcagactgagcaaatttc
EXON 8  99 bp
tatttgaaatttgaattcaaattttaaaatttcaaaacccctaacaatatgaaagtcttt
tataaaaccttccatcaacaaatgcgtttgtaggctaatgtggagtagccaacaaatttg
aggtaaatttttttagttatccactggctacctttgtatcattaatcattccatttgcag
ATCCCAAGTGTCCTTCAAGATATCACTGTACTCATGAAGCTGGTGTACATAGTGTTGGGC
TAACTTGGATTCATAAACTTCACAAATTTCTTGGATCAG
gtgagtttactaactctctgcacttttaatagatttcagaggaaaaatagatttaataga
tttcagaaaagtagtttggaatagaaaaatgatagagaaaatcagtgaaaccgaaaggtt
ctttgaaaagatcaaccacatttcacaagcctttagctagactaactataatcaagaata
EXON 9  91 bp
cttcttggggcggaaatctagaccccctgggaaagcgtatgcctatgtcagaaaagcata
gtacttgagaagcaatgttttcagacaagaacctcactgcatttaacccaatatcattag
cattttaatttggagacttgtctaagcatcatttcatttatgtaatgtcttccatggtag
ATGAAGAAGATAAGGATAGTTTACAGGAACTCTCTACAGAACAGAAATGCTTTGTTGAAC
ACATCCTTTGTACGAAGCCATTGCCCTGCAG
gtaaggactctccctcccttgtatatcagaaaacaattgttcatttcagcagttcagata
cgtttgtatccgttacactcacatccacagtattcactgctgagtcatttgaaagttgca
gacgtgatacttctcccctaagagtgtcctgctcatcagaagctttctcctctccagggc
EXON 10  102 bp
gactttagtgtggagctgcattaaaggtttccaagccaccacttttgaggttatggtact
gataggatgtcccaagcaacttcagcccaggcctgagaaggccgcggacctgtcatgtct
ttgctcttggttccattgcatttgctgctttgtaatttaactatgactgtgtttttccag
GCAGCCAGCTCCAATTCGAGGATTTTGGATTGTACCTGACATTCTGGGACCCACGATGAT
CTGCATCACCAGTACCTATGAATGCCTCATATGGCCGTTATT
gtacgtcccattttatattctccacacagctcttgttaattctgcaatatctaagttggg
aaaatgcactcagtaaccaacttgaagctatacatgtgtggtttatactttggcttctga
cttgagggttggaaggatggatatttctgttcctgccatcatctctataaggtttcattg
EXON 11  159 bp
taataagggtgtagcttcccaaagtgaccttttcaaggtggaaaacatgcattcttgcac
ttttacaaaagttacactttattttatattctgaaagttctggattaatgtggtttctgc
tttcctgtaatacagtaaatcactccatggtagaattcaatttacttacttattttgcag
AAGTACAGTCCATCCAGCGTCTCCTCCCCTGCTTTGTACTCGAGAAGATGTTGAAGTGGC
AGAGTCTCCCCTCCGTGTTCTGGCTGAAACCCCAGATTCCTTTGAAAAGCATATTAGAAG
CATTTTGCAACGTAGTGTTGCCAATCCAGCATTTTTGAA
gtatgcaaccttgggcatagcggttttatgaatgggttctcttctgtcttcagaattact
gtgcatcctttctgtcctcatctgtttcatatactttttactgtgataaatttggaagaa
actggatatatttgatcagctagtgaatggggagcaggagggaagtggcacctgagaatg
EXON 12  126 bp
aggttgcagtgagccgagatagcaccaatgcactccagcctgggtgacagagcgagactg
catctcaaataaataaattaaaaatataaaaagtttaaaaagcacctgtgacttgagtct
atttattttcagttgttttactcagctaaggaaaataaaggtagaaactttgtttttaag
AGCTTCTGAAAAGGACATAGCCCCTCCTCCTGAAGAATGCCTTCAGCTCCTCAGCAGAGC
CACCCAGGTGTTCAGAGAGCAGTACATTCTCAAACAGGACTTGGCAAAGGAGGAGATTCA
GCGGAG
gtatgatgtcctgtgttcacaaaccatcgatccctggctggtagctgatgctgtatggta
gcctagacctggcttctgaataaactctatttctttttgtttttaaagggtcaaattatt
atgtgaccaaaaaaagaaacaactagaagatctcagttattgtcgagaagagaggtaagt
EXON 13  66 bp
cagagccacccaggtgttcagagagcagtacattctcaaacaggacttggcaaaggagga
gattcagcggaggtatgatgtcctgtgttcacaaaccatcgatccctggctggtagctga
tgctgtatggtagcctagacctggcttctgaataaactctatttctttttgtttttaaag
GGTCAAATTATTATGTGACCAAAAAAAGAAACAACTAGAAGATCTCAGTTATTGTCGAGA
AGAGAG
gtaagtgtcaaaaataagaagaatacaataggtcagtaagactggaaccatattctcacc
ctaagatgctgagccacattaggtggtttcagcatcaaggggtggacctcaagagtctct
tgtgtcttacatcattaggaaaagtctgcgggaaatggctgagcgtttagctgacaaata
EXON 14  81 bp
aaagaaacaactagaagatctcagttattgtcgagaagagaggtaagtgtcaaaaataag
aagaatacaataggtcagtaagactggaaccatattctcaccctaagatgctgagccaca
ttaggtggtttcagcatcaaggggtggacctcaagagtctcttgtgtcttacatcattag
GAAAAGTCTGCGGGAAATGGCTGAGCGTTTAGCTGACAAATATGAGGAAGCTAAAGAAAA
ACAAGAGGATATCATGAACAG
gtcagtgggctgtataacatttagttacctagtcaggtactaacaacgatatttaagaaa
atgggcattggcaggtgcttacatacctacggaactgaactgatccccctgcctctcctc
tgaagtatatgttggggaaaacatgaggctctcccctaacccttcctatggggcctactt
EXON 15  127 bp
tgaactgatccccctgcctctcctctgaagtatatgttggggaaaacatgaggctctccc
ctaacccttcctatggggcctacttcagaaacaccagattcatgaattatgagcttgtga
ttatgtttctcctaattagtagagaccttaaattgagatgtttgcttgccttttctaaag
GATGAAAAAACTACTTCACAGTTTTCACTCTGAGCTCCCAGTTCTCTCTGATAGTGAGCG
AGACATGAAGAAAGAATTACAGCTGATACCTGATCAACTTCGACATTTGGGCAATGCCAT
CAAACAG
gtaggaatagatccaaactagctaaatttggtaatttttcttaaagcacttattctacag
aaaattttacaaaaatgtaaaaagaacagattcaaatagatactgtgaaaatgtgtggca
aaccactgccaaaatatctattattttaatacttaaggttactatgaaaaaggattatca
EXON 16  119 bp
atttgggcaatgccatcaaacaggtaggaatagatccaaactagctaaatttggtaattt
ttcttaaagcacttattctacagaaaattttacaaaaatgtaaaaagaacagattcaaat
agatactgtgaaaatgtgtggcaaaccactgccaaaatatctattattttaatacttaag
GTTACTATGAAAAAGGATTATCAACAGCAAAAGATGGAGAAGGTGTTGAGTCTTCCAAAA
CCCACCATTATTCTCAGTGCCTACCAGCGAAAGTGCATTCAGTCCATCCTGAAAGAGGA
gtaagtaaatacttccaatcagctattatcgtgagatagtttttcctttacagtatgcca
gaatcaacctgtcttaatagaaacctgaatcttggtatttgcatgtcaagtaattactgg
gatgagagccacatgatacatagggacttaagaaatgactatggtgggaggattgaaagg
EXON 17  170 bp
cttgcaccgtttgccaccttaaatgaatagtgaacactattgctatccacctgaaacctt
cagctgttaattttagcaaagcagttcttagatgtttcaacattaccagtttaaattctt
aagaatccatataaatggtttattataattccaaaagtgagtgactttacaattttacag
GGGTGAACATATAAGGGAAATGGTGAAGCAAATCAATGATATCCGCAATCATGTAAACTT
CTGACACCACCAGGAGCTGACTCACACCTGAACTGAACACCATTGAAGGCTTAAACCCAT
ATTGTAAAACAGGTAGAATTATCTAATTTATAAAAAGGTGTTTTGATGAC
ctttggtgtggttcatctttttaaatatgttgttttataataattgagtaaatgctttta
tttaaaatttggaatgtgctttataactcaagcctacagttgtgttcagcaaggactcag
gattatttcacactgcacactgccagaacctccctgaaccctattgagttttctccatat