Gene NME1 Variant 1
DNA : 8.45 KbNT_010783
mRNA : 732 bp NM_000269
CDS : 459 bp NP_000260
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  80 bp
gagagaagaaagcaagcagctaaccggaaaggtctgaaaaagctagcgccggaagttaaa
ctgcagaaagttgttccctagaatgactgcctactcccaagaggaagcgtgggcgagcgg
tgttctgcaaaatgggctctccggcagcggatctgcgcagaagcgttccgtgcgtgcaag
TGCTGCGAACCACGTGGGTCCCGGGCGCGTTTCGGGTGCTGGCGGCTGCAGCCGGAGTTC
AAACCTAAGCAGCTGGAAGG
gtaagaggtgttcgggatcctgagaggaaaaagaaaggagtgtagtcgcgggagtgggtt
aggtgaggagttagtgaagagatgagttcagctctaagaggcggcgaggaggatcggatg
ggaggaggggcagggagcgcctgtggacaagtgcagaccggtcggcgcacgtcccacgcc
EXON 2  130 bp
cacattgacatattagttcatagatcaggggactggggaggaattgggtttttaccagag
ggagacctggagctgacctgacagatttaaaccagctttatgggataatccgcttgagac
ggatgacgctgtaggcaagtgattcactgctgtttcattcctctacctgcctatccccag
AACCATGGCCAACTGTGAGCGTACCTTCATTGCGATCAAACCAGATGGGGTCCAGCGGGG
TCTTGTGGGAGAGATTATCAAGCGTTTTGAGCAGAAAGGATTCCGCCTTGTTGGTCTGAA
ATTCATGCAA
gtaagtggacttcattgttcccattttgattccttcatagtataggagaacactgtgatt
aacctgtttctccccgtctttcttatttaaagttctccacggtagagtgaacacaagtgt
cttgagacctggaaactcctcagtgccctagcgtttggctacatcttggaacaaaccaag
EXON 3  102 bp
agaagtacatttagtcctgtcactgctcccttccagtgtggagaatgaattgggttataa
cagaatcagtgagcccaaccgctcatgttttacatagcagggtggatgaggggaaattaa
atggattatatgtccttagatggtttgggggttattctcattctctgtcctgttgaatag
GCTTCCGAAGATCTTCTCAAGGAACACTACGTTGACCTGAAGGACCGTCCATTCTTTGCC
GGCCTGGTGAAATACATGCACTCAGGGCCGGTAGTTGCCATG
gtgagtgtgcctgtgtgggatactccaagtatgcattgcttgtcatctgtgctaggctct
cttctagacactggggatacagccatgaatgagaccaaatagatacctgttttcatatac
cagctaatggttagtgataggcttcagaaatgaaatatgcccagaaatgaataggagtag
EXON 4  113 bp
gggcagggagatcaggatcctcagtgctggaataagtggatatactctataaacatttgt
tcagtgaatgaatataatcttaaggggcctttttatttttccttttttgaattaatagtt
gccagattttctgctgtgattggttttcttctttgaccatatcttcttctgtccttggag
GTCTGGGAGGGGCTGAATGTGGTGAAGACGGGCCGAGTCATGCTCGGGGAGACCAACCCT
GCAGACTCCAAGCCTGGGACCATCCGTGGAGACTTCTGCATACAAGTTGGCAG
gtgagattttggtatttttcccccttttccaaaatctgatttagttgccacaaggatttg
ggtttccgaggctggaggtagacatgataccatatgcaggttgattttatcggagtttat
tgttttcctccctcttaagttggcgtttggctttggttgttaacatcacttagtcgtacc
EXON 5  307 bp
tggatgtggggagggcatttttcagccttaagtgaatggccattgtaggctttttctttt
aacatggtctaatgtccatggagcttcagcttttatgctgctgtggctgtagatttctgg
caatgggcgcattttaatccttctggtcttggtcatgtgactatctctttctccacccag
GAACATTATACATGGCAGTGATTCTGTGGAGAGTGCAGAGAAGGAGATCGGCTTGTGGTT
TCACCCTGAGGAACTGGTAGATTACACGAGCTGTGCTCAGAACTGGATCTATGAATGACA
GGAGGGCAGACCACATTGCTTTTCACATCCATTTCCCCTCCTTCCCATGGGCAGAGGACC
AGGCTGTAGGAAATCTAGTTATTTACAGGAACTTCATCATAATTTGGAGGGAAGCTCTTG
GAGCTGTGAGTTCTCCCTGTACAGTGTTACCATCCCCGACCATCTGATTAAAATGCTTCC
TCCCAGC
ataggattcattgagttggttacttcatattgttgcattgcttttttttccttcttttca
tgtacactgaataacctgacctaatagagagtgtaaatactataaaaatgatttattttg
aggtctcacatacacacaggcattctttgcctgcccttcttaacccccgcatcccttcca