Gene NGFR Variant 1
DNA : 19.69 KbNT_010783
mRNA : 3387 bp NM_002507
CDS : 1284 bp NP_002498
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  179 bp
gcagggagaagcgcagcggggtgcggggaaccgcacgccctccctttgcctctgcttccc
accccgaggcggcagggcgggcgggcgcggttccgggggtgggcgggctgggcggggcgg
aggcggggccgcagcactggcttcacccagcctctcccgcccgcagccagagcgagccga
GCCGCGGCCAGCTCCGGCGGGCAGGGGGGGCGCTGGAGCGCAGCGCAGCGCAGCCCCATC
AGTCCGCAAAGCGGACCGAGCTGGAAGTCGAGCGCTGCCGCGGGAGGCGGGCGATGGGGG
CAGGTGCCACCGGCCGCGCCATGGACGGGCCGCGCCTGCTGCTGTTGCTGCTTCTGGGG
gtgagtgttagccggagggggcccgctccctttcccgggatcagaactccgagaagagcc
gggcgccgccaccaaggaaacagaacagagcattggggtcccagatactgagggtgggtg
gtgggaaaggacctctgatgccgggaccacgaaggagggtctagggttcccggagcgcag
EXON 2  142 bp
tcacttgcctttcccctgtcagctttgatgttcctaacgcctccctggtgagctcatccc
agcccaggtggttctaatagaaggcagtgggaggagggtgtttgattccccggaagaacc
ccccccaacccaccccagctttctcttgccagtctgaccctccgatctccctccatccag
GTGTCCCTTGGAGGTGCCAAGGAGGCATGCCCCACAGGCCTGTACACACACAGCGGTGAG
TGCTGCAAAGCCTGCAACCTGGGCGAGGGTGTGGCCCAGCCTTGTGGAGCCAACCAGACC
GTGTGTGAGCCCTGCCTGGACA
gtgagtagagggtggcgggcaggaggaggggagaagaatgggagggaggagaggggtgaa
agggaggggcgctggggagaagcatgcccagtagaggccttataagaccaccactgtaag
gtcatcagaagtgggtctgacccagtgtaggaggcgcttctcccagattcgagaagctga
EXON 3  360 bp
gctgccaccaactttcacaggctaggggtcagggtcccttggaagagggtgggagccgat
gagaaggctgaaggaggaagtcagcgtcctggcaggcaataggggagggagagactccag
ctcctgcgtcccgggtgcccaaaagagcagacgactaaatctggtgtccgctgcgctcag
GCGTGACGTTCTCCGACGTGGTGAGCGCGACCGAGCCGTGCAAGCCGTGCACCGAGTGCG
TGGGGCTCCAGAGCATGTCGGCGCCGTGCGTGGAGGCCGACGACGCCGTGTGCCGCTGCG
CCTACGGCTACTACCAGGATGAGACGACTGGGCGCTGCGAGGCGTGCCGCGTGTGCGAGG
CGGGCTCGGGCCTCGTGTTCTCCTGCCAGGACAAGCAGAACACCGTGTGCGAGGAGTGCC
CCGACGGCACGTATTCCGACGAGGCCAACCACGTGGACCCGTGCCTGCCCTGCACCGTGT
GCGAGGACACCGAGCGCCAGCTCCGCGAGTGCACACGCTGGGCCGACGCCGAGTGCGAGG

gtgagtgcggttcggggggcggggggagtgggggtgcgggggtgggctgggggcataagg
aagggcgctctctggaggtcgacaaggaccctgcctggcctgctggggcagcttggtgac
cttgaggcagcgtgcaccttccctgagcttcagtcctttcctggtaacctaagggaggag
EXON 4  253 bp
cccacaggccttgctctttagcatcatgacatcatgcacgcaatcccagctgtgcataac
agctgggcacaagagcacctggagccagggcggggacacaggaagaacacggcagtgggt
tagagctaaaagggaggagtgggggaagtgggtcctcactcctgtggccttttctcccag
AGATCCCTGGCCGTTGGATTACACGGTCCACACCCCCAGAGGGCTCGGACAGCACAGCCC
CCAGCACCCAGGAGCCTGAGGCACCTCCAGAACAAGACCTCATAGCCAGCACGGTGGCAG
GTGTGGTGACCACAGTGATGGGCAGCTCCCAGCCCGTGGTGACCCGAGGCACCACCGACA
ACCTCATCCCTGTCTATTGCTCCATCCTGGCTGCTGTGGTTGTGGGCCTTGTGGCCTACA
TAGCCTTCAAGAG
gtaagagagggcacggtggcgacagagaggggagatgtttgccctcaaggaagactttgc
tgtgaccttgacctgaaaacatacacacccttttaactcaaccccaaaccaagctcatcc
tcactcatcatctgccgccccactccagggtgcagcaggtcagcaggaggtgaggggaga
EXON 5  161 bp
atggagctttcagggtaggtgggggcagatgtgcaaagaggagccttagatggtggggtg
gcggttataattgggcacccgccatgcccctggccctcacacggcagagcacagatactc
agctgcatcggccactacagcccctcgccccctgaaacctggcctgtcctctggctccag
GTGGAACAGCTGCAAGCAGAACAAGCAAGGAGCCAACAGCCGGCCAGTGAACCAGACGCC
CCCACCAGAGGGAGAAAAACTCCACAGCGACAGTGGCATCTCCGTGGACAGCCAGAGCCT
GCATGACCAGCAGCCCCACACGCAGACAGCCTCGGGCCAGG
gtgagcagcggcccgctggggagctgaggcggagctgaggctgaggaaacagaagcaatt
aagattagactccaggaaggactgtcgggggggcggcagggctggctcagcggtgcccct
gtagatggatggagaggctggccgaggggaatgggagggagaggtcctctctagaggaac
EXON 6  2292 bp
gacaacgagtccccccaggtgccttcacttcctggtgccccacccaggaccttgtcttgg
ccccaggcctccagatggggaggagcactgcctcggcccttcttgggtctcaccccagtg
cccactgttggggaaaggagttcaggggtaggacctgactctcctctggtttctctgcag
CCCTCAAGGGTGACGGAGGCCTCTACAGCAGCCTGCCCCCAGCCAAGCGGGAGGAGGTGG
AGAAGCTTCTCAACGGCTCTGCGGGGGACACCTGGCGGCACCTGGCGGGCGAGCTGGGCT
ACCAGCCCGAGCACATAGACTCCTTTACCCATGAGGCCTGCCCCGTTCGCGCCCTGCTTG
CAAGCTGGGCCACCCAGGACAGCGCCACACTGGACGCCCTCCTGGCCGCCCTGCGCCGCA
TCCAGCGAGCCGACCTCGTGGAGAGTCTGTGCAGTGAGTCCACTGCCACATCCCCGGTGT
GAGCCCAACCGGGGAGCCCCCGCCCCGCCCCACATTCCGACAACCGATGCTCCAGCCAAC
CCCTGTGGAGCCCGCACCCCCACCCTTTGGGGGGGGCCCGCCTGGCAGAACTGAGCTCCT
CTGGGCAGGACCTCAGAGTCCAGGCCCCAAAACCACAGCCCTGTCAGTGCAGCCCGTGTG
GCCCCTTCACTTCTGACCACACTTCCTGTCCAGAGAGAGAAGTGCCCCTGCTGCCTCCCC
AACCCTGCCCCTGCCCCGTCACCATCTCAGGCCACCTGCCCCCTTCTCCCACACTGCTAG
GTGGGCCAGCCCCTCCCACCACAGCAGGTGTCATATATGGGGGGCCAACACCAGGGATGG
TACTAGGGGGAAGTGACAAGGCCCCAGAGACTCAGAGGGAGGAATCGAGGAACCAGAGCC
ATGGACTCTACACTGTGAACTTGGGGAACAAGGGTGGCATCCCAGTGGCCTCAACCCTCC
CTCAGCCCCTCTTGCCCCCCACCCCAGCCTAAGATGAAGAGGATCGGAGGCTTGTCAGAG
CTGGGAGGGGTTTTCGAAGCTCAGCCCACCCCCCTCATTTTGGATATAGGTCAGTGAGGC
CCAGGGAGAGGCCATGATTCGCCCAAAGCCAGACAGCAACGGGGAGGCCAAGTGCAGGCT
GGCACCGCCTTCTCTAAATGAGGGGCCTCAGGTTTGCCTGAGGGCGAGGGGAGGGTGGCA
GGTGACCTTCTGGGAAATGGCTTGAAGCCAAGTCAGCTTTGCCTTCCACGCTGTCTCCAG
ACCCCCACCCCTTCCCCACTGCCTGCCCACCCGTGGAGATGGGATGCTTGCCTAGGGCCT
GGTCCATGATGGAGTCAGGTTTGGGGTTCGTGGAAAGGGTGCTGCTTCCCTCTGCCTGTC
CCTCTCAGGCATGCCTGTGTGACATCAGTGGCATGGCTCCAGTCTGCTGCCCTCCATCCC
GACATGGACCCGGAGCTAACACTGGCCCCTAGAATCAGCCTAGGGGTCAGGGACCAAGGA
CCCCTCACCTTGCAACACACAGACACACGCACACACACACACAGGAGGAGAAATCTCACT
TTTCTCCATGAGTTTTTTCTCTTGGGCTGAGACTGGATACTGCCCGGGGCAGCTGCCAGA
GAAGCATCGGAGGGAATTGAGGTCTGCTCGGCCGTCTTCACTCGCCCCCGGGTTTGGCGG
GCCAAGGACTGCCGACCGAGGCTGGAGCTGGCGTCTGTCTTCAAGGGCTTACACGTGGAG
GAATGCTCCCCCATCCTCCCCTTCCCTGCAAACATGGGGTTGGCTGGGCCCAGAAGGTTG
TGATGAAGAAAAGTGGGCCAGTGTGGGAATGCGGCAAGAAGGAATTGACTTCGACTGTGA
CCTGTGGGGATTTCTCCCAGCTCTAGACAACCCTGCAAAGGACTGTTTTTTCCTGAGCTT
GGCCAGAAGGGGGCCATGAGGCCTCAGTGGACTTTCCACCCCCTCCCTGGCCTGTTCTGT
TTTGCCTGAAGTTGGAGTGAGTGTGGCTCCCCTCTATTTAGCATGACAAGCCCCAGGCAG
GCTGTGCGCTGACAACCACCGCTCCCCAGCCCAGGGTTCCCCCAGCCCTGTGGAAGGGAC
TAGGAGCACTGTAGTAAATGGCAATTCTTTGACCTCAACCTGTGATGAGGGGAGGAAACT
CACCTGCTGGCCCCTCACCTGGGCACCTGGGGAGTGGGACAGAGTCTGGGTGTATTTATT
TTCCTCCCCAGCAGGTGGGGAGGGGGTTTGGGGGCTTGCAAGTATGTTTTAGCATGTGTT
TGGTTCTGGGGCCCCTTTTTACTCCCCTTGAGCTGAGATGGAACCCTTTTGGCCCCCGAG
CTGGGGGCCATGAGCTCCAGACCCCCAGCAACCCTCCTATCACCTCCCCTCCTTGCCTCC
TGTGTAATCATTTCTTGGGCCCTCCTGAAACTTACACACAAAACGTTAAGTGATGAACAT
TAAATAGCAAAG
aaagaaaaatagtacaaagagattttctggaaatacacatggtttgaattgtttgggatt
gggtgtgtggcagggacccaggtataatttccaattcggtcaattcctgccctcttttcc
cccacaccaaaaggggaagttttaacagaaatccagtaagttcccatgtatcactatggg