Gene MAPK7 Variant 4
DNA : 5.04 KbNT_030843
mRNA : 2900 bp NM_002749
CDS : 2451 bp NP_002740
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  137 bp
ccctttgggcggctcccgccggcgagctggacagcggcgcgcgccaggcgtggctttctc
ggccggtgggctaggattggacgcagtaggtagaaggggcaggaccctccgcagcagtag
ctcagcgattggccaggagctggagggagcgtggccttgggaggcggggcggagggggac
GGACAGGGCAGCTCAAGACGCTGAGGTGGTGGCTGCGGCCTTTGAACAAGTAAGTGAGCC
ACCCTCGGAGACCCCCGCGCTGGGGACGGGAGGCCGGCGAGCCTCGGGACCTCTGAAAGC
CTTGAGGAGGCGCGGGG
gtgagtgcggccctgaggaaacccaggtgccccgcccctccctttcttcctggcccgcgc
ctcgcctacccctcccccgaccctggcgggcccccggctctgggcccggacccctggggt
agctagtctgccacgaaccagccgcgcgcttctgcccttgtcggtttaggaaactgggaa
EXON 2  237 bp
gcgggcccccggctctgggcccggacccctggggtagctagtctgccacgaaccagccgc
gcgcttctgcccttgtcggtttaggaaactgggaagttccctggtcctgctccccagccc
gcagaggggacactgaggcccacggtaggtggtcctctcctcacccgagtctccacacag
ACACCATGGCCGAGCCTCTGAAGGAGGAAGACGGCGAGGACGGCTCTGCGGAGCCCCCCG
GGCCCGTGAAGGCCGAACCCGCCCACACCGCTGCCTCTGTAGCGGCCAAGAACCTGGCCC
TGCTTAAAGCCCGCTCCTTCGATGTGACCTTTGACGTGGGCGACGAGTACGAGATCATCG
AGACCATAGGCAACGGGGCCTATGGAGTGGTGTCCTCCGCCCGCCGCCGCCTCACCG
gtgagcttcctgagccgtcgcctcccagatgtggcagcgtcgcagggagtgggaaaccgg
cctgtcccagacagccgggaaggaaagcggggtgcgagttctggctccagtcaacacaca
ctgaccagggccttctgcctgccaggctccggggaggctcggttctctgaaactccggcc
EXON 3  166 bp
gaaggtaacatttaataatgtaggtaacatgcttagcacagggcttggcacatagtaggt
acccaatacttggtagctgttgtcatttgcatcctagaagggaggtgttgataggggctg
agtcgactctgcagtttctccaaggtatcctctggtatgtcccttttccctgctcctcag
GCCAGCAGGTGGCCATCAAGAAGATCCCTAATGCTTTCGATGTGGTGACCAATGCCAAGC
GGACCCTCAGGGAGCTGAAGATCCTCAAGCACTTTAAACACGACAACATCATCGCCATCA
AGGACATCCTGAGGCCCACCGTGCCCTATGGCGAATTCAAATCTGT
gtaagaagcgggatgggagagggagccagacttgggacttttctgaaggctgcaaccatg
ttgccgaagttctggaaaggcagctgaatctaatctgaagcaggctgggaaaattcccgc
agttctaggaccagttctttagagttttgccagggacaactgttattcctcaagaagtgt
EXON 4  1079 bp
ggaaaagtcgtagagaatctaaaacgtgatgctcttcttccataccatgccgtcagcccc
tatggggtcccagggtaaggctgttacctgtctggaatcggaagggtgtggtgaggatgg
ggcttgtccctggagtgtgatcaggccaacccatgcttctctccttccttccccttccag
CTACGTGGTCCTGGACCTGATGGAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCC
CCTCACACTGGAACACGTGCGCTACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACAT
GCACTCGGCTCAGGTCATCCACCGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAA
CTGTGAGCTCAAGATTGGTGACTTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGA
ACATCAGTACTTCATGACTGAGTATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCAT
GCTCTCTTTGCATGAGTATACACAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGG
TGAGATGCTGGCCCGGCGCCAGCTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCT
CATCATGATGGTGCTGGGTACCCCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAG
GGTGCGGGCCTATATCCAGAGCTTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTA
CCCAGGTGCCGACCGCCAGGCCCTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAG
CGCTCGCATCTCAGCAGCTGCTGCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCC
TGATGATGAGCCTGACTGTGCCCCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCAC
TCGGGAGCGCATTAAGGAGGCCATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGA
GGGCATCCGCCAACAGATCCGCTTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGG
CTGTCCAGATGTTGAAATGCCCAGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTC
TCCACCACCAGCCCCGCCACCATGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCT
GCAGCCACCTCCACCAGTCAGTGAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGA
CAATACTAAGGCTGCCCTTAAAGCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAG
gtgccttgtgggcaggtcgggtgggcagaggggagacttggacttggacaaggcttcagg
cttttaccttctcccctgcccaacttccccgcagatggccccagcgcacccctggaggct
cctgagcctcggaagccggtgacagcccaggagcgccagcgggagcgggaggagaagcgg
EXON 5  686 bp
accaaagaaagatggtgccatctcagacaatactaaggctgcccttaaagctgccctgct
caagtctttgaggagccggctcagaggtgccttgtgggcaggtcgggtgggcagagggga
gacttggacttggacaaggcttcaggcttttaccttctcccctgcccaacttccccgcag
ATGGCCCCAGCGCACCCCTGGAGGCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGC
GCCAGCGGGAGCGGGAGGAGAAGCGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGA
AACGGCGGCAGGAGCGGGAGCGAAAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCA
CTGACCCCTTGGCTGGACTAGTGCTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGA
CTCGAATGGCCCGGCCCGCAGCCCCAGCCCTCACCTCTGTGCCGGCCCCTGCCCCAGCGC
CAACGCCAACCCCAACCCCAGTCCAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGC
CCACTGGCCCGCAACCACAATCTGCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCT
GCCCACCCCCTGGCCCTGCACCCCACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCG
CGCCACCCCAGATTGCCACCTCCACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCC
CTGGGCTGCCTGGCTCCAGCACCCCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGC
CCCCAGACGCCGGGGGAGCCCCTCAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTG
TGACCCAGCAGCTATCTAAGTCACAG
gtgagagggaggcccaggccatggggacacctgggtctgggccaaaggaaaatgggttca
ggaagcggtcagtgttccacaaaaactgagcagcagatggggctttatctctgaacgtgt
cctcttgctcacagaaggagcataatggcaatgaagaggttgttaggagacaagttaaat
EXON 6  134 bp
gagacaagttaaatatggcctgcaaagtgcctagcccagagatggggccagccagcactc
actgactgccgagactggtgttagcactcccagatatccaggcggagtagtcagcagcat
tgggacagggtggcctacagacctcagtctgtctgcattgtaacctgtcattccctgcag
GTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGCTAC
GGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCTGAT
GGGCCACAGGATGG
gtaaggtggctggactgagctcctagactgggactgtggggagaggttcctggtgcagga
gacatgcacctgtgggatgggtgagggtccagcctaggctaatagcacccctccctttcc
ttcccctgcagccaggcagattcagcctctctctcagcctccctgcttgctgactggctc
EXON 7  461 bp
tcttaaaccagtctttcgacatgggcgtggctgatgggccacaggatgggtaaggtggct
ggactgagctcctagactgggactgtggggagaggttcctggtgcaggagacatgcacct
gtgggatgggtgagggtccagcctaggctaatagcacccctccctttccttcccctgcag
CCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGACTGGCTCGAAGGCCATGG
CATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAGATGGACTCCCCAATGCT
GCTGGCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCA
CAGTAGACCTAGTTCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAG
CAGGTGAGGCTCGGCTTGGATTATTCTGCAGGTTCATCTCAGACCCACCTTTCAGCCTTA
AGCAGCCACCTGAGCCACCACCGAGCCATGGCAGGATCGGGAGACCCCAACTCCCCCTGA
ACAATCCTTTTCAGTATTATATTTTTATTATTATTATGTTATTATTACACTGTCTTTTTG
CCATCAAAATGAGGCCTGTGAAATACAAGGTTCCCTTCTGC
acctgactccaggtgtaatttttggagttcggggtaggacaccatcagcaggggagcaag
gaggagccaggtgcctacatttgggggataaacaaatatgtttgtgtgtatgaagccagt
tcattcaggttctgaaggtttattgagaccttcagtccctacccactcccagccctgcag