Gene MAPK7 Variant 2
DNA : 5.78 KbNT_030843
mRNA : 2709 bp NM_139032
CDS : 3774 bp NP_620601
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  349 bp
gctccctttagaaaacctttccttccagctcacagtatccaccatgtccaccttcgcctc
ccggcactgagccttagaggggcggtgctccataaacatttgctacatgaatgaacgaat
aaactatcggattttggggtgggtcgggacagctcggttccagcgagggctccgcccacc
CGCGGGCTCCGCAGAGGAGCAGAGGTTGGGCGGCCGCCTCGGTTAACTCCGCTGCAGCCC
AAAGCACGGGAATCGCGGGACAGACAAACGAGCGGAGGGAAGATACCTAGAAGCCAGGAA
ACCGCGAGCTGCAGTCCAACTTGGCCGGAAGCTGCGGAGAGGCTCAGCCACCGGAAGTCA
GTGGAGGGTTCGGCCGGACGCTCTAGAATCCCGGAGGACCGGGATCTCTGTGGTTGGCCG
TGACGGGCACCCTCTACCGGGGATGACACATTCCCAGAGCTCCTGGGACCAAGCAAATGG
CGGACACAATTCCCTGGGCGGAAGGGGACTTCGGGAGCCAGTAGCCAAG
gtaacagtcccagacctgggcatctcaggccgggcagttccccgagctcacgggactagc
tgtgattggccggatgaggttgagagcttcatggggacgcgcgcgctacgtgcaggggcg
ttgccttccattcacttggcgcccgactgccagtgcgcatgcgtttgaaggcggtgcagg
EXON 2  1079 bp
ggaaaagtcgtagagaatctaaaacgtgatgctcttcttccataccatgccgtcagcccc
tatggggtcccagggtaaggctgttacctgtctggaatcggaagggtgtggtgaggatgg
ggcttgtccctggagtgtgatcaggccaacccatgcttctctccttccttccccttccag
CTACGTGGTCCTGGACCTGATGGAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCC
CCTCACACTGGAACACGTGCGCTACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACAT
GCACTCGGCTCAGGTCATCCACCGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAA
CTGTGAGCTCAAGATTGGTGACTTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGA
ACATCAGTACTTCATGACTGAGTATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCAT
GCTCTCTTTGCATGAGTATACACAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGG
TGAGATGCTGGCCCGGCGCCAGCTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCT
CATCATGATGGTGCTGGGTACCCCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAG
GGTGCGGGCCTATATCCAGAGCTTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTA
CCCAGGTGCCGACCGCCAGGCCCTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAG
CGCTCGCATCTCAGCAGCTGCTGCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCC
TGATGATGAGCCTGACTGTGCCCCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCAC
TCGGGAGCGCATTAAGGAGGCCATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGA
GGGCATCCGCCAACAGATCCGCTTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGG
CTGTCCAGATGTTGAAATGCCCAGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTC
TCCACCACCAGCCCCGCCACCATGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCT
GCAGCCACCTCCACCAGTCAGTGAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGA
CAATACTAAGGCTGCCCTTAAAGCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAG
gtgccttgtgggcaggtcgggtgggcagaggggagacttggacttggacaaggcttcagg
cttttaccttctcccctgcccaacttccccgcagatggccccagcgcacccctggaggct
cctgagcctcggaagccggtgacagcccaggagcgccagcgggagcgggaggagaagcgg
EXON 3  686 bp
accaaagaaagatggtgccatctcagacaatactaaggctgcccttaaagctgccctgct
caagtctttgaggagccggctcagaggtgccttgtgggcaggtcgggtgggcagagggga
gacttggacttggacaaggcttcaggcttttaccttctcccctgcccaacttccccgcag
ATGGCCCCAGCGCACCCCTGGAGGCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGC
GCCAGCGGGAGCGGGAGGAGAAGCGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGA
AACGGCGGCAGGAGCGGGAGCGAAAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCA
CTGACCCCTTGGCTGGACTAGTGCTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGA
CTCGAATGGCCCGGCCCGCAGCCCCAGCCCTCACCTCTGTGCCGGCCCCTGCCCCAGCGC
CAACGCCAACCCCAACCCCAGTCCAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGC
CCACTGGCCCGCAACCACAATCTGCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCT
GCCCACCCCCTGGCCCTGCACCCCACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCG
CGCCACCCCAGATTGCCACCTCCACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCC
CTGGGCTGCCTGGCTCCAGCACCCCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGC
CCCCAGACGCCGGGGGAGCCCCTCAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTG
TGACCCAGCAGCTATCTAAGTCACAG
gtgagagggaggcccaggccatggggacacctgggtctgggccaaaggaaaatgggttca
ggaagcggtcagtgttccacaaaaactgagcagcagatggggctttatctctgaacgtgt
cctcttgctcacagaaggagcataatggcaatgaagaggttgttaggagacaagttaaat
EXON 4  134 bp
gagacaagttaaatatggcctgcaaagtgcctagcccagagatggggccagccagcactc
actgactgccgagactggtgttagcactcccagatatccaggcggagtagtcagcagcat
tgggacagggtggcctacagacctcagtctgtctgcattgtaacctgtcattccctgcag
GTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGCTAC
GGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCTGAT
GGGCCACAGGATGG
gtaaggtggctggactgagctcctagactgggactgtggggagaggttcctggtgcagga
gacatgcacctgtgggatgggtgagggtccagcctaggctaatagcacccctccctttcc
ttcccctgcagccaggcagattcagcctctctctcagcctccctgcttgctgactggctc
EXON 5  461 bp
tcttaaaccagtctttcgacatgggcgtggctgatgggccacaggatgggtaaggtggct
ggactgagctcctagactgggactgtggggagaggttcctggtgcaggagacatgcacct
gtgggatgggtgagggtccagcctaggctaatagcacccctccctttccttcccctgcag
CCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGACTGGCTCGAAGGCCATGG
CATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAGATGGACTCCCCAATGCT
GCTGGCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCA
CAGTAGACCTAGTTCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAG
CAGGTGAGGCTCGGCTTGGATTATTCTGCAGGTTCATCTCAGACCCACCTTTCAGCCTTA
AGCAGCCACCTGAGCCACCACCGAGCCATGGCAGGATCGGGAGACCCCAACTCCCCCTGA
ACAATCCTTTTCAGTATTATATTTTTATTATTATTATGTTATTATTACACTGTCTTTTTG
CCATCAAAATGAGGCCTGTGAAATACAAGGTTCCCTTCTGC
acctgactccaggtgtaatttttggagttcggggtaggacaccatcagcaggggagcaag
gaggagccaggtgcctacatttgggggataaacaaatatgtttgtgtgtatgaagccagt
tcattcaggttctgaaggtttattgagaccttcagtccctacccactcccagccctgcag