Gene MAP2K6 Variant 2
DNA : 40.90 KbNT_010641
mRNA : 2824 bp NM_031988
CDS : 837 bp NP_114365
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  257 bp
gtggagtctgttcagttctgtttctccttgccgaagtgtggtctttggagctaagtgaag
aatgacttctgttaggttttcctctgctggtcttccttgcagcctcgaaaacctcaccag
agtcgcctctgctggtctcttactgtgctgctctgtcagagatgggcaagtaagcgaact
GCAGAGTGTTGCTGTGTGTGCTTGTGATTTGTATTTTATTTGATGTAAACGTGAAGGCAG
AGTATTTTCTAACACTGTAATTCAACTAGGTTTTGTGTCTCCTGGATCTATTTTTTTTTC
TTGTTGTTCTGAGGAGCTGATATACTTGGAAATATTAGGTTTAAGATATGCAGATGTCCA
ACTTATATACATAGTCAAGGGTTTAGAGTCTGGAGACAGGAGGCTGGCAATTTCAACTAG
GAGGCAGTAAATTCAGG
gtaagaatgatgttgatgtggggggctgtgggggtggctgggtgtaacagtgatctgggg
agagaatcaaaggccttctcctcccacttggaagactttactattattttggtcttttat
tcctttggtctctgtgctaaaaactttctctcttttttactgtttctttgtatagatgtt
EXON 2  67 bp
tctgtcctacctggtgcttgggttcttaacactcacagacttcctgggtaggaagtggcg
ctttgaatggagacatgagagctgcctgtgcaggtcagctctttcctttgccgcagtctc
tttctctgctatcttgctatgatttagtccttaactttttccttttgtctttccccatag
GCAAGAAGCGAAACCCTGGCCTTAAAATTCCAAAAGAAGCATTTGAACAACCTCAGACCA
GTTCCAC
gtaagttgacaagaccatcatctgaatccaaatccttgtgctttcagattcctcctgggg
gtttatttttggactgctgagcaatgccttgactttagaagagccctttaagggggaagc
catttgctcactgttctgagacctgaaatagtcatcttatcagtcagttacgttgaatgg
EXON 3  49 bp
ttaaacccaaatgtgatttatttcaaatcccctcttattcacactcataggctgctttag
tttactcatgaacttccactttcttcttaaggaaaaaatatcctcagtggtgtgtgattt
gggaaggacataattgactcaatagcttatgtttcttcttttcccccttatctttcttag
ACCACCTCGAGATTTAGACTCCAAGGCTTGCATTTCTATTGGAAATCAG
gtaagaaaaaatcatgtctgccacctaatacgttggccattttatatgtatgctttctga
ctgaaaaatttattttccctagcatgctgtcaggggatgagtcaaaaaaagtttgcattt
aaagggaagtggtatgcaaagtttttgctattttgaaagaatgttgaattgaaatcaggc
EXON 4  114 bp
agacatctcttggcccttcttgtagcttcttgctttcagaggctgctttgacatgctaga
aaatcttctggcccagaaataatccttagaacattgagagaaacgagatagaggataatg
tgctctctgttctgtttatttttctctttcccattgcattattccttttctctcttgcag
AACTTTGAGGTGAAGGCAGATGACCTGGAGCCTATAATGGAACTGGGACGAGGTGCGTAC
GGGGTGGTGGAGAAGATGCGGCACGTGCCCAGCGGGCAGATCATGGCAGTGAAG
gtagagttgacattctcccaaatgttttatatctgctgtgtatacatttgtccacctcaa
ttgtcaaccagcccttttaatagaagcaaaaccatcttccgtagggtaaaacagaaaaga
ttatttgcagggaacagtattttcctccaaaggtatggaaaagtcttccttggtgtgagt
EXON 5  120 bp
atgagtaacagccttccttattttcatgtgttacaaatagctaatcactttgggtggcta
ttcacaatgtcatcgccagaacttgtgtcatgaactattttcacgatgggactccttcag
gtccctgcctgcctcatcctcagagtagtaaccataaattttccatgcatttccattcag
CGGATCCGAGCCACAGTAAATAGCCAGGAACAGAAACGGCTACTGATGGATTTGGATATT
TCCATGAGGACGGTGGACTGTCCATTCACTGTCACCTTTTATGGCGCACTGTTTCGGGAG

gtaggtgacccttcaattcaaagtccaagaggaacaataacttaaaaagaagtttctttg
atcacgtaaatgccttcacaatcatggagctctttcttgtttgacacatcttgtatacgg
gggtttacgtgtgtgcaatgatgacatgccctggagcaaggttggattgaaattatggta
EXON 6  117 bp
tagataaccttgcttatttgtaaattcctttatgatcttgacagaagacactgtatttcc
ccccaaaattcaagaaagaaatagttaattcttcaggatagggtttactgtttttttttt
ttatttttatttctccctttttcatccttttaaacaattcctgaaacaattggtctccag
GGTGATGTGTGGATCTGCATGGAGCTCATGGATACATCACTAGATAAATTCTACAAACAA
GTTATTGATAAAGGCCAGACAATTCCAGAGGACATCTTAGGGAAAATAGCAGTTTCT
gtgagtacattttgatccctactgcaaggataatgtgagaaataaagtccctatgtgtct
ttggacctcagtatgaagaaatactacctgggccacagctactattcgtacatgtctgtt
gacatttattggtggatggataaatacatgctttcctttctgagcactgtgtagaagatt
EXON 7  52 bp
tctggtggatggagtccaatttgtgtaacttcctatgtattttcctagataggaccacca
ctatttgagaaaatatctcactggtaacctaaagccaaggataataaaccttgatatact
taacattcaatttctttccagcaatgtgataaataaatctatcttgtgtttctcttgcag
ATTGTAAAAGCATTAGAACATTTACATAGTAAGCTGTCTGTCATTCACAGAG
gtaagcatccatgagctgccttggctgttcctttgataaagttcatctctttcacctgga
gtccgtctctacccccagtcccccatgggtggaagtagaattgactcaggcaagagaact
aaggggctttcctttgagattggatagcaaaccatataagtagtattccttatcatggct
EXON 8  128 bp
tcaagttgaaagcaataagctgttgttaactgtgggtcagggatggcagttacttctgtg
ttgggcagcttggggaaaggaagatgaaggacaaatggagattttaggccctctggtggc
agagaaatgaaccttgaaagcaggctgaaatgatggcatcctggttgttttcgctttcag
ACGTCAAGCCTTCTAATGTACTCATCAATGCTCTCGGTCAAGTGAAGATGTGCGATTTTG
GAATCAGTGGCTACTTGGTGGACTCTGTTGCTAAAACAATTGATGCAGGTTGCAAACCAT
ACATGGCC
gtaagtacattagctagggtggcatctggtaatgtcactgccgacaaatcatgctgggaa
acaagaaatggatggccacagagggaaaatggaaatgtacctaagactccagaagtagtc
tgcctcttagtatttcttcaaaattttatgtctgaaatctttactcacttgcttcgtata
EXON 9  78 bp
accccacggaggcattgatatttgttgtagttaaccgggtcttcttggccttggtggcat
gttaacagcttataacaactcacttggcagctggtgctacccccatccccagagactatt
gagctaagaacgttatctcaattgtcttcccagtttctcagttgtctgtcttctttccag
CCTGAAAGAATAAACCCAGAGCTCAACCAGAAGGGATACAGTGTGAAGTCTGACATTTGG
AGTCTGGGCATCACGATG
gtagtgtatgccaatcatcatgaactatgaggttgtgggtaatgaaactagaatgaggtg
gacgttgggttcaagaaacaaatgccctaaatgctggtttggggcgccctctcctgctga
gctggtaggagattttgagtaataattgtttgtattgtggtacaataaaaacactgatat
EXON 10  140 bp
aggaatttggggaaaattgctagagaacaaattattagtttatttcctgcccccctaccc
ctggacttatacttgaactttgccttgtgtttcctgctgtctatccacaaatgaaacgtg
ggtgattccctaaagcagccctgttgaaactgttgtctccttttttcttcttttctccag
ATTGAGTTGGCCATCCTTCGATTTCCCTATGATTCATGGGGAACTCCATTTCAGCAGCTC
AAACAGGTGGTAGAGGAGCCATCGCCACAACTCCCAGCAGACAAGTTCTCTGCAGAGTTT
GTTGACTTTACCTCACAGTG
gtaagacagcctcacctcccaagtgtcagtgtgaaagaagaagatgagttctcatgaatt
tcttccatcggggttgaatccatcatgcatacattcattccgaaagcatttgtggagtat
gccctctctgctggagaagcaaagatgaccgtatcacactccctgccctcactgagccca
EXON 11  46 bp
ccagggtgatttaaaacatgatacataagtgttacagaagaggaaagtcaagataggagg
ctgtgttttcaatacacttttaaagctgattatgtttagtgttctacaggttctgaaatc
cttgtctaatgaaaatatatatggcttctagattttaatgattatttttttttctttaag
CTTAAAGAAGAATTCCAAAGAACGGCCTACATACCCAGAGCTAATG
gtgagtattgttagcaacgtaaacatgactatactgatagctacaaaaggcaaagtcact
aagacctaaattatcatcacatcaccatattggaagagttggttcattgatacatcagtg
acaggaattgaactccaggaaagagagttaaagagttcatcctacatccttcttaaacat
EXON 12  1656 bp
tatctttaaaatgtttgcatcactagatgtgtgcttgattttggaaagggtaggaaaagc
ccagcctagctctgatagggatacttaatccctgtaccaagcagatctattcatttgcta
atctcatatattgattgtcagtaagacattaataccatgttttttctttttcttttccag
CAACATCCATTTTTCACCCTACATGAATCCAAAGGAACAGATGTGGCATCTTTTGTAAAA
CTGATTCTTGGAGACTAAAAAGCAGTGGACTTAATCGGTTGACCCTACTGTGGATTGGTG
GGTTTCGGGGTGAAGCAAGTTCACTACAGCATCAATAGAAAGTCATCTTTGAGATAATTT
AACCCTGCCTCTCAGAGGGTTTTCTCTCCCAATTTTCTTTTTACTCCCCCTCTTAAGGGG
GCCTTGGAATCTATAGTATAGAATGAACTGTCTAGATGGATGAATTATGATAAAGGCTTA
GGACTTCAAAAGGTGATTAAATATTTAATGATGTGTCATATGAGTCCTCAAGCTTCTCAG
ACTTCTCTTATTCTTTACAAAATGAATGCATTGGCCCTGACAAAAAGGTGCTACGGTAGT
GATGAAATTATAAGTAGATTTGTAGTTTGTCCCATTTATTATTTTAATATTTATGTTTAA
GTGCTTGGTTGAAAAGATTCCATTTTATACAAGAAGGGAGATTCAAAAAAAAAATATAAG
GTTGGGTTAGCAATATTTATAGGGCTTTTATTTTTTAAGTTCAATTGTGTCTGTGGTCCA
GAAGAAATTATTTAATATGCATCTTTGAGAATATTATAAAAATATCAAAAAGGAGCTCTT
CTTGTGAAATGTCTGTTCCAGCTGTTGTGACTGCTGCCATTTTTGCAAACATCTGCCCAA
TCCTGGGTGATCACCACATCTTTTAGGGGAAGTGACAAGATGCTCTGGTCATACTCTTTT
TCCCAACTTTGGAAAACATAAAAATCACTCATATAACAGCTCAAAGAGTAAAACATTTGG
TTCTTCTGACACTTGTGGTATAGTATTAGTGGAAAGTGATTTGTAATATGATTTTATATC
CACCTACCTATTCATCTACCTGTGTGTATGTGTGTGTTTGTGTGTCTATTTGGCAATTCA
CAAGTCCTGCCAAGTGGTTTCTATGAGCATCTCTGTTTGGTAAGGAGGACAATTGTCAGT
TTTGAGGGGGACATGTGTTAAATCACAGAAAAAAATGGTGCCTTCTTCTGCGTTTGTCCC
TCCTGCCATGTGTAAGTTGTAAGGATTGCCTTTGTAGTTAATGTACTCTTTGGCTTTGTT
TGTTTGTTTTCTTCTTCAGTGAAGCAGCCTTACTATTCATAGAAGGGCTAGAATAGGAGA
AAATGAAAGGTAGTGAGTAATTCTTTGATAAGATGAGGAAATAATGGGAAAGGTTGAATT
AATTCCTGGGCATGGACTACCAGATGACCACAAGTTGCGTTGAGGCCGCATCTTTCTTCA
GCAGCGTGCAATAGCTGGCTCCTCTATAGGAGATGAGCTTCATTGGGAGTTCCTAGCAAG
TTGACTAAACAGCAAAAGTTCTTTCTCGTGGGTAAATATACCCACAGGTTCTATGATTTG
TAGCTCTAGGTTTCTTGATGATCAAGGAGTGAAGTAATTGACAGGGAAAATATAGACCTA
TGATAAATAACCAGGAAGCATTGCTTTTGGACAAGGAAGGACAGAGGGTTTTGATTTTAA
AAAGAAGAAAAAAAAACCTTATTTTTTCTTTCTTGGCCTCAAGTTCAATATGGAGAGGAT
TGCTTCCCTGAATCCTCTCTTCCTTCCCCTTTTAGA
ttttgaagtgcaatcatatgtttttctctgtttgcattttttcctccttgttcttgacaa
ggaggagttgctcctgcccagaatgagcgtgacacttccgaacacttcttcatattcagt
tccaagatatatctgcttgattaaacatgagcttcctctgctctgaagctacctctgtcc