Gene LLGL2 Variant 1
DNA : 49.48 KbNT_010641
mRNA : 3480 bp NM_004524
CDS : 3048 bp NP_004515
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  100 bp
cggggccgcggattggcaggagcgcagcccccacccccgagggtgcccccgcccctgcgg
cgccgagctggggggcgggccgggggcggggcgctgggccccggcaggctcgccctttat
gtaaatagcgcggctccgccccaggctcgccgcgccggaggtgagcaggaaggagacggc
CGCCCAGCAGCCCGTGGGCAGGCGCGGCGGAGCGAGCGGGGCCGGCGGCGGGCGCCGAGG
GACGCCGAGGCCTCGGGCGGGGGCTGGCCCGGGGTTCCAG
gtgagatgcgtgccggactcgcccagccgggcccgccccctcggggcttccacctggggc
ggggaggccagggaggcccaggacccctgggctgtcgggccagggcgggagggctgcgcc
caggtccgcgcgcctcgcccctgtccgcgtcgctgtgctggcctggaagagagacacctg
EXON 2  105 bp
gcctctagatctgagcgtggggaagccagggtgcatgggcggtcactgtgaagctggcct
ggccccggggtggcagcctactggacttggagagagaggccctgctccacctgtttgggc
cgggcctaatcgatacctgagtgccaggacagacccctgcagctccttctgtttctccag
GTCTCCAGTGGGGGCTGCAGACTAAGCAAAATGAGGCGGTTCCTGAGGCCAGGGCATGAC
CCTGTGCGGGAGAGGCTCAAGCGGGACCTGTTCCAGTTTAACAAG
gtaagttagggagagcagggaagatgacccccaggttttcggccaagcagctcaggctgg
ggctgaggcacctcttacctggattaaggtatagctcttatgtgactgcctgcagtgcct
cttgggactcagactttggaaatggggcctggttaaagggcttttatagaaaaggggaat
EXON 3  98 bp
gggacagggggtggggcctggtaaatatgggttaggctccaacactcaggtgtctgggag
gaaccggaaaggtaccgaagccctgcttcctgctgggtcgtctggtgctgcagctgcagc
agccatggtggcgcgaaggggacaggtctgcaggcccaccccacgtgcttctcgttgcag
ACGGTGGAGCATGGCTTCCCGCACCAGCCCAGCGCCCTCGGCTACAGCCCGTCCCTGCGC
ATCCTGGCCATCGGCACCCGTTCTGGAGCCATCAAGCT
gtatcctccgtcccctcgctcccactcgggcagggccttggggtgggtgagatttgggga
gggacatcttttccttccttgcccgtgggctgttgggataaaatgagggactttcctgat
ttccagttttggacatgattttattccaaaatggggcaggtatggttgatggtggagcag
EXON 4  82 bp
agggccagggctgctgtgtctcctccccaccctaggctccatgcatgggtcctgctgcct
cgggggagggcagcccctctctgtgtttgcatcattgcacatgggccccgagggcctggc
actcaaggcaggcaggggatggtgtccgaccttccagagctttcctgagcctactcctag
CTACGGAGCCCCAGGCGTGGAGTTCATGGGGCTGCACCAGGAGAACAACGCTGTGACGCA
GATCCACCTCCTGCCCGGCCAG
gtgagggacctggggtgggacaggaagccacttccatgccctccttgccttcactgcttc
cagcagggctggtgtggagaggctggcattcggtggccctgggtttgctgctgatggaaa
gacctgggaccccctccctttccacagctggggctcatgggccaccctgggagtggccag
EXON 5  116 bp
gccctgggtttgctgctgatggaaagacctgggaccccctccctttccacagctggggct
catgggccaccctgggagtggccagggggtcttttaaacaactggggctgcgtggcccca
gtgtgtaaaggccttgcctgggtagcaagaccacatgatcccgtcgtgtgccctcgccag
TGCCAGCTGGTCACCCTGCTGGATGACAACAGCCTGCACCTTTGGAGCCTGAAGGTCAAG
GGCGGGGCATCGGAGCTGCAGGAGGATGAGAGCTTCACACTGCGTGGACCCCCAGG
gtaagggctcaatccccagccccttccactcccagcccagcctgacccttgcccttagct
ctggagtggactcaccctttgtgaggcctgttgcgcccctggcagtgactggcatgcgtt
tggcccgatgcatcgccacactcaggtgctccgagtggagtgggcggggctgcagcctgc
EXON 6  159 bp
ggctctctgccatctgtctcctgtcttggcagaaagtgaccaatgtttgtcctggcttga
aatgttatgacctcattaaagggccttatgggcttgttttccgaggagtcaggggacccc
gtccatggcatctcccctgctgggcagtggtcggctcacgggcagctgttcttgtcacag
GGCTGCCCCCAGTGCCACACAGATCACCGTGGTCCTGCCACATTCCTCCTGCGAGCTGCT
CTACCTGGGCACCGAGAGTGGCAACGTGTTTGTGGTGCAGCTGCCAGCTTTTCGTGCGCT
GGAGGACCGGACCATCAGCTCGGACGCGGTGCTGCAGCG
gtgagcccagagcccagctgctgttaactccatcccctcaagttaggcatggcttctccc
cttggtcccaggactctgtcaggagctgtcatttctctgctgggaattccatggggctat
agcaggggaggctcttggcttcctacctgtcacctactgagaacctattggcctgtcata
EXON 7  163 bp
ctgggattacaggcatgagccaccacgctcggccatccactgcgcccagcccctagccat
atttctatgctggcacatggagcagccacctctgcatagggagccccatggctgtgccat
gctgggggccattccccctggtggacggcatcggaggctcacggcactcccctcgcccag
GTTGCCAGAGGAGGCCCGCCACCGGCGTGTGTTCGAGATGGTGGAGGCACTGCAGGAGCA
CCCTCGAGACCCCAACCAGATCCTGATCGGCTACAGCCGAGGCCTCGTTGTCATCTGGGA
CCTACAGGGCAGCCGCGTGCTCTACCACTTCCTCAGCAGCCAG
gtaggcagtgcccaggacatggcaggcgccatgttgctctcccagggccccaagtggcac
atacacactgtgcagaggcatggggtgcaggcgatgggaacgccgcctcggtccagcgtg
ctgccctctgtccctctcctcttcctccatagcaactggagaacatctggtggcagcggg
EXON 8  133 bp
cgtgctctaccacttcctcagcagccaggtaggcagtgcccaggacatggcaggcgccat
gttgctctcccagggccccaagtggcacatacacactgtgcagaggcatggggtgcaggc
gatgggaacgccgcctcggtccagcgtgctgccctctgtccctctcctcttcctccatag
CAACTGGAGAACATCTGGTGGCAGCGGGACGGCCGCCTGCTCGTCAGCTGTCACTCTGAC
GGCAGCTACTGCCAGTGGCCCGTGTCCAGCGAAGCCCAGCAACCAGAGCCCCTCCGCAGC
CTCGTGCCTTACG
gtcagtgtttcacccgccgggcagggcccacccccagtgcctcctggattcaggtgcagg
ttgctcaattctgaagcaaactccagggccagagagggtaaaggctttgtccaaagccac
acagcagggttcgcctcacccagtttcttggggaacttctcggagcaagattcccaagca
EXON 9  55 bp
gtccaaagccacacagcagggttcgcctcacccagtttcttggggaacttctcggagcaa
gattcccaagcacaggtctaccatgtggatgtggcatgagctagagggatctgtgcctgt
ggggactgacacttgtctgagagtttgaggatccgttcaagccgattcctttcctttcag
GTCCCTTTCCTTGCAAAGCGATTACCAGAATCCTCTGGCTGACCACTAGGCAGGG
gtaggtatccatgctggtcctctttcctctccagagccttcctggagggctagaaaggtc
acttaggcctctgcctgggaagttggtgccagtgaacactctcaggtcccgtgttggggt
cttggacaccagggaggggagacagggtagacgctattcacgtctctcagcggcccaatt
EXON 10  155 bp
agcctggatgccctcaccttacctccaagtcctcctgggctgtagcagttggaaggagat
ggggtccagtctcccctgctcctggggaccttgactgagtggtgactttgattgccggcc
tgtggctgttgaggctgtgccaggagccccagcccactgccgctcctctgtgcctgccag
GTTGCCCTTCACCATCTTCCAGGGTGGCATGCCACGGGCCAGCTACGGGGACCGCCACTG
CATCTCAGTGATCCACGATGGCCAGCAGACGGCCTTCGACTTCACCTCCCGTGTCATCGG
CTTCACTGTCCTCACAGAGGCAGACCCTGCAGCCA
gtaggagagcttcgggagtgggtgcccagggttaggtgtgggaggcatggggcaggacca
tcagtaaagacagggccaggtgcagtggctcctgcctgtaaccccagtgctgtgggaggc
caaggtggtaggatcgcttgaacccaggagttcaagtccagcctggacaacgtagggaga
EXON 11  218 bp
agccagggctactgcccacacctgctgccctcctggagatggaaaggctttgctcaagca
gccaagaacagggctttctggatctgcagatgccctggctccaaccctggagcttctgat
tccacagagctgggctgcttcctcctggccccggcccctgacccttgccctgtaccccag
CCTTTGACGACCCCTATGCCCTGGTGGTGCTGGCTGAGGAGGAGCTGGTGGTGATTGACC
TGCAGACAGCAGGCTGGCCACCGGTCCAGCTGCCCTACCTGGCTTCTCTGCACTGTTCCG
CCATCACCTGCTCTCACCACGTCTCCAACATCCCGCTGAAGCTGTGGGAGCGGATCATTG
CCGCCGGCAGCCGGCAGAACGCACACTTCTCCACCATG
gtaggtctggccctggccccagccccagccccaccgcaagccaaactctcccatggactt
cttggtctctttttctaggagtggccaattgatggtggcaccagcctgaccccagcccca
ccccagagggacctgctgctcacagggtagggtactttgatgctaccccacctcttccca
EXON 12  68 bp
tccgccatcacctgctctcaccacgtctccaacatcccgctgaagctgtgggagcggatc
attgccgccggcagccggcagaacgcacacttctccaccatggtaggtctggccctggcc
ccagccccagccccaccgcaagccaaactctcccatggacttcttggtctctttttctag
GAGTGGCCAATTGATGGTGGCACCAGCCTGACCCCAGCCCCACCCCAGAGGGACCTGCTG
CTCACAGG
gtagggtactttgatgctaccccacctcttcccagtaggatatgtggggtgggagcagag
ccctgaggtggacgagccagcccctgggcatcccggctggcatccctctcacgcctggca
ggtgggttctgcccacaggcacgaggacggcacggtgcggttctgggatgcctcgggtgt
EXON 13  154 bp
cctgaccccagccccaccccagagggacctgctgctcacagggtagggtactttgatgct
accccacctcttcccagtaggatatgtggggtgggagcagagccctgaggtggacgagcc
agcccctgggcatcccggctggcatccctctcacgcctggcaggtgggttctgcccacag
GCACGAGGACGGCACGGTGCGGTTCTGGGATGCCTCGGGTGTCTGCCTGCGGCTGCTCTA
CAAACTCAGCACTGTGCGCGTGTTCCTCACCGACACGGACCCCAACGAGAACTTCAGTGC
CCAGGGCGAGGACGAGTGGCCCCCACTCCGCAAG
gtgaggccaggagcctgggacccaggaagggcagaggccagctgggtcctgtccccgtgg
ctgctcacagggcccctccccttctccaggtgggctcctttgacccctacagtgatgacc
cccggctgggcatccagaagatcttcctctgcaagtacagcggctacctggctgtggcag
EXON 14  105 bp
actcagcactgtgcgcgtgttcctcaccgacacggaccccaacgagaacttcagtgccca
gggcgaggacgagtggcccccactccgcaaggtgaggccaggagcctgggacccaggaag
ggcagaggccagctgggtcctgtccccgtggctgctcacagggcccctccccttctccag
GTGGGCTCCTTTGACCCCTACAGTGATGACCCCCGGCTGGGCATCCAGAAGATCTTCCTC
TGCAAGTACAGCGGCTACCTGGCTGTGGCAGGCACGGCAGGGCAG
gtagcaggctgggctggggagggggagctggggaggagtggtcgatgactggggacagca
gggacaggagccaaccacctgcctaacgcacattctgtgtcctttgcttttccggtggat
ggaggtggcttgatccccttggcgggaggtccctgggatggttgtttcttctccagaaat
EXON 15  293 bp
acagagcaagacttgtctcaaaaaaaaaaaaaaaaaatgcaggagagctggggttggaca
gaggcctttgtccttccttgagccttgggcccagctcctttgctgtccccactagtagca
tcctgcggccctgccgtccctttgctgagggcttgctgagccacctgccaccctgcgcag
GTGCTGGTACTGGAACTGAATGACGAGGCAGCGGAGCAGGCTGTGGAGCAGGTGGAGGCC
GACCTGCTGCAGGACCAAGAGGGCTACCGCTGGAAGGGGCACGAGCGCCTGGCAGCCCGC
TCAGGGCCCGTGCGCTTTGAGCCTGGCTTTCAGCCCTTCGTGTTGGTGCAGTGTCAGCCC
CCGGCTGTGGTCACCTCCTTGGCCCTGCACTCTGAGTGGCGGCTCGTGGCCTTCGGCACC
AGCCATGGCTTTGGCCTCTTTGACCACCAGCAGCGGCGGCAGGTCTTTGTTAA
gtgagcaggggcggctgggtcccggggctgggagtggggcccgcgaggactcccaggacc
tagcagcactgacagcctgccatccccccaaggtgcacactgcaccccagtgaccagctg
gccttggagggcccactctcccgcgtcaagtccctcaagaagtccttgcgtcagtcattc
EXON 16  151 bp
tgcactctgagtggcggctcgtggccttcggcaccagccatggctttggcctctttgacc
accagcagcggcggcaggtctttgttaagtgagcaggggcggctgggtcccggggctggg
agtggggcccgcgaggactcccaggacctagcagcactgacagcctgccatccccccaag
GTGCACACTGCACCCCAGTGACCAGCTGGCCTTGGAGGGCCCACTCTCCCGCGTCAAGTC
CCTCAAGAAGTCCTTGCGTCAGTCATTCCGCCGGATGCGTCGGAGCCGGGTGTCCAGCCG
GAAGCGGCACCCGGCTGGCCCCCCAGGAGAG
gtgaggcctgaggtgaggctgcggccggccacgcacccaggttcggctcagagcagccag
caggggggccacacggcccctgctccccaggcttgctaggctacaaacaagattcagggt
ccaggtcgcattgtgtgacctcagacaggtcacgctgcttctctctgcctcagcttcctg
EXON 17  151 bp
cccaggcaggctcccccaagggcacctccctcttggacaagggtccctctagacgcaggc
ctggcaggtggctggcatggctgtggcctgccttccgatgcaaggatcagcactgagcga
agcactgttcctggggaggggagtccagagctgacccttaggctggcccaccccttgcag
GCACAGGAGGGGAGTGCCAAGGCTGAGCGGCCAGGCCTCCAGAACATGGAGCTGGCGCCT
GTGCAGCGCAAGATCGAGGCTCGCTCGGCAGAGGACTCCTTCACAGGCTTCGTCCGGACC
CTGTACTTTGCTGACACCTACCTGAAGGACA
gtgagtggccagcctggggttggggggcagggggtagtgggcagcagacaccccctgacc
tgggggcatgccgggggctgctgcctgcctggctggtaggagctaagaggtttccccttg
tgagcaggggcagactgcagcccctgcctgcttactcccctcccctgcctcagcctctga
EXON 18  117 bp
tgtatcacagcaagggctgagctgacctgggattggggtcttctatgttggggcctgtgt
ggttgtcagagagccttccagcctctcccaggagggaaaacctgggagtaaaccctggtt
gcccagctccacccgactcccacgctaagggtcagacacccaaacatggcttctcggcag
GCTCCCGGCACTGCCCCTCGCTGTGGGCTGGCACCAATGGGGGCACCATCTATGCCTTCT
CCCTGCGTGTGCCTCCCGCCGAGCGGAGAATGGATGAGCCTGTGCGGGCAGAGCAGG
gtgagtgctgggcagggagagcagagggtgctcgggctgcctgggctgggtccagggagt
ggctccagccctgccaccccctcaccagccccaacacccacctcctccccctagccaagg
agatccagctgatgcaccgggcgccggtggtgggcatcctggtgctcgacggacacagcg
EXON 19  167 bp
atgccttctccctgcgtgtgcctcccgccgagcggagaatggatgagcctgtgcgggcag
agcagggtgagtgctgggcagggagagcagagggtgctcgggctgcctgggctgggtcca
gggagtggctccagccctgccaccccctcaccagccccaacacccacctcctccccctag
CCAAGGAGATCCAGCTGATGCACCGGGCGCCGGTGGTGGGCATCCTGGTGCTCGACGGAC
ACAGCGTACCCCTTCCCGAGCCCCTCGAAGTGGCCCATGATCTGTCGAAGAGCCCTGACA
TGCAGGGAAGCCACCAGCTGCTCGTCGTATCAGAGGAGCAGTTCAAG
gtgccacacgggcagcggcgggtctccctgggactccccgggacatccaggaggctcgga
ccttgggcaaaaatgatggctgggactcagtcttgtttgcagttggtgtctgaggggctg
cagaagtacaggaaataagtgaggggggagtctcgtgtgaggacactgaggcaggacagg
EXON 20  265 bp
aaaatccagatagggaagtcggtgacctcggcatcctcccaggccatgtctgtgcatctg
agagccaagggtttgtcaggacaccgggaggcatgtggggaggggagggcccagcagcag
cagcacagggcaggagaactggtttggccatgggcatgaacaaccaccccacgcccccag
GTGTTCACGCTGCCCAAGGTGAGTGCCAAGCTGAAGTTGAAGCTGACGGCCCTGGAGGGC
TCAAGAGTGCGGCGGGTCAGCGTGGCCCACTTCGGCAGTCGTCGAGCCGAGGACTACGGG
GAGCACCACCTGGCAGTCCTTACCAACCTGGGCGACATCCAGGTGGTCTCGCTGCCCCTG
CTCAAGCCCCAGGTGCGCTACAGCTGCATCCGCCGGGAGGACGTCAGTGGCATCGCCTCC
TGCGTCTTCACCAAATATGGCCAAG
gtgtttgagccgggctgggtgggtgtcggggccccgggcactgcacggacgggaagggtg
gccaggggtgttgtggccacggccagactggatgggccttaagcggagaactgcgaggga
gcactagcccctactcccccaggtggggaggcagccttggcagccgccaggccaggccgc
EXON 21  151 bp
gtgtcggggccccgggcactgcacggacgggaagggtggccaggggtgttgtggccacgg
ccagactggatgggccttaagcggagaactgcgagggagcactagcccctactcccccag
gtggggaggcagccttggcagccgccaggccaggccgctagcattgcccccactccccag
GCTTCTACCTGATCTCACCCTCGGAGTTTGAGCGCTTCTCTCTCTCCACCAAGTGGCTGG
TGGAGCCCCGGTGTCTGGTGGATTCAGCAGAAACCAAGAACCACCGCCCTGGTAACGGTG
CGGGCCCCAAGAAGGCCCCGAGCCGAGCCAG
gtgagtgaaagggccagaggcctctcccgcccctcccgcccctccctgccctctctgaga
taccgaggctcccactgctgcctggctggaggcacctccccacgagctcagcccaccctc
ccaggctccggctctccttgcctctttgcgtgccccttgcccctgtgcaagctggcagtc
EXON 22  29 bp
cctctttgcgtgccccttgcccctgtgcaagctggcagtccagggcaggactcagtttac
ctcccaggctctccggctcaggacaggctgcgccattgacttgttcttcatgggaccagg
gctctcagagccgggcagggagcccgggggccctggtcctcactgtctcttcccccacag
GAACTCAGGGACTCAGAGTGATGGCGAGG
gtaagacaggcctcctgggctcatgcacacctgggccacacccggcccagacctggggct
ggacgggagggaagggtcccgagtgagcaggtagtgtttgggctgggaatagagacggca
ttccttccagccctgggccctgggcttccacatcctgacctcagtaaggagagagagagc
EXON 23  48 bp
ctggggctggacgggagggaagggtcccgagtgagcaggtagtgtttgggctgggaatag
agacggcattccttccagccctgggccctgggcttccacatcctgacctcagtaaggaga
gagagagccaggccgaggagggcccaggcggggcgccctgacccggcctctaccttccag
AGAAGCAGCCCGGCCTGGTGATGGAGCGCGCTCTGCTCAGTGATGAGA
gtgagttgggtgggagagggtggggctggcaggaggggtggggaaggggggtcagggtca
agggaggctgggcaggccactgccctgaggcggggtacagatccatgggcacccacggag
aaagggggtggaagggctgtggctagccgccccaagggcctcagtgggcctctgttccca
EXON 24  59 bp
ctctgttcccacccggcctgcaggagtcctgaaggaaatccagagcacactggagggaga
ccgcgggtgaggcaccgcccaggccagctggggtgggcccgaggctctgccagagggctc
aggggagcgctgagagtggaggtccctgaggccatgactcccctgtctttgcctgtgcag
GAGCGGCAACTGGCGTTCACATCGAGCCGCCGTGGGGTGCAGCCTCAGCAATGGCGGAG
gtgggggctctgggcttgagtgcagctgccaaccgtgctgggaagggctgggaggaagag
ccccggccccactcccctgggtcccacggggctgacacgtgccctgatgaccaggaaagc
accatgtctgggctcagcgtgggcggctggggcaccccgtcctgcccagggtgatcttga
EXON 25  338 bp
cagctgccaaccgtgctgggaagggctgggaggaagagccccggccccactcccctgggt
cccacggggctgacacgtgccctgatgaccaggaaagcaccatgtctgggctcagcgtgg
gcggctggggcaccccgtcctgcccagggtgatcttgagctgtccctctgtgtccttcag
CAGAGTGAGTGGCTGAGCGTCCAGGCTGCGCGATGAGCACACACTACTACTGATGGCCTT
TCGGGGGTCCCTGCCCCAACCGGAGAGGCCGGTGCACAGGGCCCCGCCAGGGGCTGGGGG
CATCCCGGCTTCCACAATGCAGCTGCTCTGGGCCTCGGGAGAGGAGAGACCCCAGTCCCC
TGGGCTGCCCTTCCCGGGCCTCGTCTGTCTGGGTCCTTTGGTCAATGTTGCACAGTTTTT
ATTGCTCCCATCCCTTTTTGTAGTGGGCTGGGTTTTAAGTTATAAATGTTAACTGCCTCT
GGGTGAAAAAGTTTTTAATAAACACCTATTACCTCTTG
actggtccactactttaatattttaattgtgtagaaattttccatgtgaatggaaagtgg
gagccggtaccctgcctgtcccccgaggctccagccctggcctgggccggtgtcaggaga
atccacttggggagccgtgtgaatcaaactgcttcgttttgtctgagcccggcggtgcct