Gene LASP1 Variant 1
DNA : 51.65 KbNT_010755
mRNA : 3845 bp NM_006148
CDS : 786 bp NP_006139
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  144 bp
ccacgtcgcccggagagcgcgcctcgctgcgcgtgcccttgcccgcgcccgaggcgcgtg
cccgccccagtgcagcccctcctccccgctgtgtttattaggggaaggagggcggaggcg
gaggccagttccccagctccagccgccgtcgctgctgcctgtgtagttgcagccgcggcc
GCCTCCCGCCAGCTCGCCTCGGGGAACAGGACGCGCGTGAGCTCAGGCGTCCCCGCCCCA
GCTTTTCTCGGAACCATGAACCCCAACTGCGCCCGGTGCGGCAAGATCGTGTATCCCACG
GAGAAGGTGAACTGTCTGGATAAG
gtgagcccgggaccgggagacgcgtctttgcaatcccccgcagtgctccgaatccaggga
ggagagaagggccgggtctttgccgccttatccccgcgatcccaggagaatggagggagg
gcgagcgggcggtgtcatggggtgtggggacacatcccagtctgaaaaccaggagatctg
EXON 2  95 bp
ggggagtgccaaagcctgtgacctgaaatgcccccagctcacctgggatgattccatgtt
ctccccacagccatgggcctaggacagtcccagcagctcctgagtgccccttcctagggc
ctgagcccctttttcagaagtcctggtatctgatgtatgtcctcctgtctccatccccag
TTCTGGCATAAAGCATGCTTCCATTGCGAGACCTGCAAGATGACACTGAACATGAAGAAC
TACAAGGGCTACGAGAAGAAGCCCTACTGCAACGC
gtgagtcctgttctgggcagggggctgggtgggcaccttggctccctccccgagtgagtt
cttcctttccttccaataaccgcaaggtgacattggcgaacacttccatcccctacttga
acatcacagtttgtcctcacaacagctgaatgaagcaagcactttttatccccatttaaa
EXON 3  85 bp
tctgagaaacgcttgtctcccctcggccttggtggtggacactgaagtcctcctgtgggg
ccgggccagggcgtgcccaagcataggacgaagttcccaggagggcatgctctgtgagaa
gcccagaggctcctgcccctcccccagagtcacccccactctgttttttctgtcctgcag
ACACTACCCCAAGCAGTCCTTCACCATGGTGGCGGACACCCCGGAAAACCTTCGCCTCAA
GCAACAGAGTGAGCTCCAGAGTCAG
gtgaggggctgggcggtgctggggcctggcagggagggatgctggggagggaagttgtaa
ggtcggcatttggcaagagtaccttcccctgcggttactctgcaaggccaaggtgctgaa
atcctagcattgcctttaatcttgaccccacccctgactttatcaaaggagcagggtaga
EXON 4  108 bp
tattacgagtctaacaccttttggctgaggcctctgctttgagttggggacttctgatca
gggtctttctgctgactccctgtccctgtctcctgactggttgctgcctcagaggggccc
caagccgaggccctttcggctcctggcctgactccaatccctcttcctcccctcctgcag
GTGCGCTACAAGGAGGAGTTTGAGAAGAACAAGGGCAAAGGTTTCAGCGTAGTGGCAGAC
ACGCCCGAGCTCCAGAGAATCAAGAAGACCCAGGACCAGATCAGTAAC
gtgagctcttgccctgccctgcggcatccctgctgccctctgtttggtccccttcctgcc
agcctggcagacgcaagcctggcagatgtgaatgaggccagtgcctccactacccctgcc
ctccagggtgggcctggggaagagcttggggttcccagatgcctcttctctgtgtacccc
EXON 5  151 bp
ggcttggcaagattaggtagcttgtccaaggacacacagctggtgcttccagagcgagac
ctggctttctgtacccaaagctcttgggtagtctctcccatcctgggatcttgagggtca
cgggaaggaactgggtggtttgcagtgggacccttcacctagtgccttctgaccttgcag
ATAAAATACCATGAGGAGTTTGAGAAGAGCCGCATGGGCCCTAGCGGGGGCGAGGGCATG
GAGCCAGAGCGTCGGGATTCACAGGACGGCAGCAGCTACCGGCGGCCCCTGGAGCAGCAG
CAGCCTCACCACATCCCGACCAGTGCCCCGG
gtgagtgcaggtcctgttggtgcagatgacctgaggcgaggccagtggggtggggaggaa
gccaggagaagacagacagacagatacaccttccggagccttgctcttaatcaacaggcg
attatgcctcttgtgtgcaagaggggaccagaggacctgaggccgggccagctggggtgg
EXON 6  104 bp
cccctgcgtgggatacaacacacaggcaaatgtgcacacgtggacatcagcctttgagct
gtggggcttgagccaggttgggggcggggtggaagtgcatggtatggacttctcgggagc
tctgggaggggctgggtttggcaggacagtttccaagccctgtctcctcccatcttccag
TTTACCAGCAGCCCCAGCAGCAGCCGGTGGCCCAGTCCTATGGTGGCTACAAGGAGCCTG
CAGCCCCAGTCTCCATACAGCGCAGCGCCCCAGGTGGTGGCGGG
gtgagtaaccctggccggaggggagaggccagaggcagggggtccttcgggaaggcttgg
acacagctcatggattctcctgacctttgcacccaccctctgttgtgtgtgatgataagg
atctcagccttgtgagcagagaggaaattggttggcgtagtgggcagaggctggctggga
EXON 7  3158 bp
gattgctctcagaaagcaagacacagaggttaagaatctttgcagcagagcctggtgctc
catttctgagttcactgctcccccaggctctgctccagggtcgtggagagttagaaaaaa
atgctcagacccaggtgagccggcatgcagggccctaggctgaccacacttcccccacag
AAGCGGTACCGCGCGGTGTATGACTACAGCGCCGCCGACGAGGACGAGGTCTCCTTCCAG
GACGGGGACACCATCGTCAACGTGCAGCAGATCGACGACGGCTGGATGTACGGGACGGTG
GAGCGCACCGGCGACACGGGGATGCTGCCGGCCAACTACGTGGAGGCCATCTGAACCCGC
AGCGCCCCCATCTGTCTTCAGCACATTCCACGGCATCGCATCCGTCCTGGGCGTGACCCG
TCCATTCTTCAGTGTCTCTGTTTTTTAAAACCTGCGACAGCTTGTGATTCCTACCCCTCT
TCCAGCTTCTTTTGCCAACTGAAGCCTTCTTCTGCCACTTCTGCGGGCTCCCTCCTCTGG
CAGGCTTCCCCCTTGATCGACTTCTTGGTTTTCTCTCTGGATGGAACGGGCATGGGCCTC
TCTGGGGGAGGCAGGGCTGGAATGGGAGACCTGTTGGCCTGTGGGCCTCACCTGCCCCTC
TGTTCTCTCCCCTCACATCCTCCTGCCCAGCTCCTCACATACCCACACATTCCAGGGCTG
GGGTGAGCCTGACTGCCAGGACCCCAGGTCAGGGGCTCCCTACATTCCCCAGAGTGGGAT
CCACTTCTTGGTTCCTGGGATGGCGATGGGGACTCTGCCGCTGTGTAGGGACCAGTGGGA
TGGGCTCTACCTCTCTTTCTCAAAGAGGGGGCTCTGCCCACCTGGGGTCTCTCTCCCTAC
CTCCCTCCTCAGGGGCAACAACAGGAGAATGGGGTTCCTGCTGTGGGGCGAATTCATCCC
CTCCCCGCGCGTTCCTTCGCACACTGTGATTTTGCCCTCCTGCCCACGCAGACCTGCAGC
GGGCAAAGAGCTCCCGAGGAAGCACAGCTTGGGTCAGGTTCTTGCCTTTCTTAATTTTAG
GGACAGCTACCGGAAGGAGGGGAACAAGGAGTTCTCTTCCGCAGCCCCTTTCCCCACGCC
CACCCCCAGTCTCCAGGGACCCTTGCCTGCCTCCTAGGCTGGAAGCCATGGTCCCGAAGT
GTAGGGCAAGGGTGCCTCAGGACCTTTTGGTCTTCAGCCTCCCTCAGCCCCCAGGATCTG
GGTTAGGTGGCCGCTCCTCCCTGCTCCTCATGGGAAGATGTCTCAGAGCCTTCCATGACC
TCCCCTCCCCAGCCCAATGCCAAGTGGACTTGGAGCTGCACAAAGTCAGCAGGGACCACT
AAATCTCCAAGACCTGGTGTGCGGAGGCAGGAGCATGTATGTCTGCAGGTGTCTGACACG
CAAGTGTGTGAGTGTGAGTGTGAGAGATGGGGCGGGGGTGTGTCTGTAGGTGTCTCTGGG
CCTGTGTGTGGGTGGGGTTATGTGAGGGTATGAAGAGCTGTCTTCCCCTGAGAGTTTCCT
CAGAACCCACAGTGAGAGGGGAGGGCTCCTGGGGCAGAGAAGTTCCTTAGGTTTTCTTTG
GAATGAAATTCCTCCTTCCCCCCATCTCTGAGTGGAGGAAGCCCACCAATCTGCCCTTTG
CAGTGTGCAGGGTGGAAGGTAAGAGGTTGGTGTGGAGTTGGGGCTGCCATAGGGTCTGCA
GCCTGCTGGGGCTAAGCGGTGGAGGAAGGCTCTGTCACTCCAGGCATATGTTTCCCCATC
TCTGTCTGGGGCTACAGAATAGGGTGGCAGAAGTGTCACCCTGTGGGTGTCTCCCTCGGG
GGCTCTTCCCCTAGACCTCCCCCTCACTTACATAAAGCTCCCTTGAAGCAAGAAAGAGGG
TCCCAGGGCTGCAAAACTGGAAGCACAGCCTCGGGGATGGGGAGGGAAAGACGGTGCTAT
ATCCAGTTCCTGCTCTCTGCTCATGGGTGGCTGTGACAACCCTGGCCTCACTTGATTCAT
CTCTGGTTTTCTTGCCACCCTCTGGGAGTCCCCATCCCATTTTCATCCTGAGCCCAACCA
GGCCCTGCCATTGGCCTCTTGTCCCTTGGCACACTTGTACCCACAGGTGAGGGGCAGGAC
CTGAAGGTATTGGCCTGTTCAACAATCAGTCATCATGGGTGTTTTTGTCAACTGCTTGTT
AATTGATTTGGGGATGTTTGCCCCGAATGAGAGGTTGAGGAAAAGACTGTGGGTGGGGAG
GCCCTGCCTGACCCATCCCTTTTCCTTTCTGGCCCCAGCCTAGGTGGAGGCAAGTGGAAT
ATCTTATATTGGGCGATTTGGGGGCTCGGGGAGGCAGAGAATCTCTTGGGAGTCTTGGGT
GGCGCTGGTGCATTCTGTTTCCTCTTGATCTCAAAGCACAATGTGGATTTGGGGACCAAA
GGTCAGGGACACATCCCCTTAGAGGACCTGAGTTTGGGAGAGTGGTGAGTGGAAGGGAGG
AGCAGCAAGAAGCAGCCTGTTTTCACTCAGCTTAATTCTCCTTCCCAGATAAGGCAAGCC
AGTCATGGAATCTTGCTGCAGGCCCTCCCTCTACTCTTCCTGTCCTAAAAATAGGGGCCG
TTTTCTTACACACCCCCAGAGAGAGGAGGGACTGTCACACTGGTGCTGAGTGACCGGGGG
CTGCTGGGCGTCTGTTCTTTACCAAAACCATCCATCCCTAGAAGAGCACAGAGCCCTGAG
GGGCTGGGCTGGGCTGGGCTGAGCCCCTGGTCTTCTCTACAGTTCACAGAGGTCTTTCAG
CTCATTTAATCCCAGGAAAGAGGCATCAAAGCTAGAATGTGAATATAACTTTTGTGGACC
AATACTAAGAATAACAAGAAGCCCAGTGGTGAGGAAAGTGCGTTCTCCCAGCACTGCCTC
CTGTTTTCTCCCTCTCATGTCCCTCCAGGGAAAATGACTTTATTGCTTAATTTCTGCCTT
TCCCCCCTCACACATGCACTTTTGGGCCTTTTTTTATAGCTGGAAAAAACAAAATACCAC
CCTACAAACCTGTATTTAAAAAGAAACAGAAATGACCACGTGAAATTTGCCTCTGTCCAA
ACATTTCATCCGTGTGTATGTGTATGTGTGTGAGTGTGTGAAGCCGCCAGTTCATCTTTT
TATATGGGGTTGTTGTCTCATTTTGGTCTGTTTTGGTCCCCTCCCTCGTGGGCTTGTGCT
CGGGATCAAACCTTTCTGGCCTGTTATGATTCTGAACATTTGACTTGAACCACAAGTGAA
TCTTTCTCCTGGTGACTCAAATAAAAGTATAATTTTTA
cctgcggacttggtttcctctctggctctgagctgctgttgtgtgtgtctgtgtgtgggt
gtgtgtctctagctgtaaggtgctgctgtgtgtgtgtgtgtctagctgtaaggtgccact
gtgtgtgtgtgtgtgtgtgtgtcctgtctgcttgggggcactggcctgtggccctcctgg