Gene KRT12 Variant 1
DNA : 5.91 KbNT_010755
mRNA : 1867 bp NM_000223
CDS : 1485 bp NP_000214
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  591 bp
ttcgattatttctgtatcaatgaattttcattatacataaatcattcacttgttgagctg
gccaaaaacctggggggaggatccaattttgagtggagaaagtgaacttttcaactgcga
cacccatcttgcagcctatataagtttagctttctggcttgctggcacaacttcctctcc
AGTTGTGGCCACCTTCCCCAGGCCATGGATCTCTCCAACAACACCATGTCACTCTCAGTG
CGCACCCCCGGACTGTCCCGGCGGCTCTCCTCGCAGAGTGTGATAGGCAGACCCAGGGGC
ATGTCTGCTTCCAGTGTTGGAAGTGGTTATGGGGGAAGTGCCTTTGGCTTTGGAGCCAGC
TGTGGGGGAGGCTTTTCTGCTGCTTCCATGTTTGGTTCTAGTTCCGGCTTTGGGGGTGGC
TCCGGAAGTTCCATGGCAGGAGGACTGGGTGCTGGTTATGGGAGAGCCCTGGGTGGAGGT
AGCTTTGGAGGGCTGGGGATGGGATTTGGGGGCAGCCCAGGAGGTGGCTCTCTAGGTATT
CTCTCGGGCAATGATGGAGGCCTTCTTTCTGGATCAGAAAAAGAAACTATGCAAAATCTT
AATGATAGATTAGCTTCCTACCTGGATAAGGTGCGAGCTCTAGAAGAGGCTAATACTGAG
CTAGAAAATAAAATTCGAGAATGGTATGAAACACGAGGAACTGGGACTGCAGATGCTTCA
CAGAGCGATTACAGCAAATATTATCCACTGATTGAAGACCTCAGGAATAAG
gtaagatctcttttggaggcgctttgggaattttttttttcctttttaccattacaatgt
tttacagtgataatcacctacaactttgatattttccaatttagctgtacttgcagcaat
tttctcatcccaggttgtttcactccactttatcatttactaagaaatgattgtatttcc
EXON 2  83 bp
gcatttctttacttctcaatattattttatacagatattgtcttagaaaaatgaaactgt
cttaaactctaaataaaacagcatttaatatcaccattttcacctttgtgtcaaaaatat
atttgtataatactagtcttttagggcttcaatcttgtgtgtgtccctctcttttgccag
ATCATTTCAGCCAGCATTGGAAATGCCCAGCTCCTCTTGCAGATTGACAATGCGAGACTA
GCTGCTGAGGACTTCAGGATGAA
gtgagtcgaataaactgaagatcatgggcgtgtcccaccatgtcttctgtcctactgtcc
tgccttcattgatataaaatcttctgaagttcacatactccatatatttactgttttggt
aaattcacatagggtgttctagaaagtaattagaatctaatgcaattcagattaaatgtc
EXON 3  157 bp
agtaaacaatggtgggaaaaaaggaaaggaaaaacacaacagcaaaaactgcatcataca
ctacaatgctgccattattaagtaggtgcacagatttaagcaagaaatagccctgaagat
cagtggccttgttcaaatggttgtgttgattccctcaactgctttgcacttggttttcag
GTATGAGAATGAACTGGCCCTGCGCCAGGGCGTAGAGGCCGACATCAATGGCCTGCGCCG
GGTGCTGGACGAGCTGACCCTGACCAGGACCGACCTGGAGATGCAGATCGAGAGCCTGAA
CGAGGAGCTGGCCTACATGAAGAAGAACCACGAGGAT
gtgagtcagacagggcagcctcactcagctacttttttttttctcccagacccaaaaatt
acaatttcaaatttagaaatctggagtcaggacaagtatggagaatacattgtctccctg
ttaaaatggccatttgttttagatttctgtgtgatgtgtgtggtatgtgtgtgtgtgatg
EXON 4  162 bp
attacattaatatatttgtctttataccaacagtcataagatagaatttttaagtgtgtg
tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtaggaaggggcccaagaggacaaaagtatc
cagggcccacgaaagtcacaatggacccctgtgcccctctctctcacatgctgtccccag
GAGCTCCAAAGCTTCCGGGTGGGCGGCCCAGGCGAGGTCAGCGTAGAAATGGACGCTGCC
CCCGGAGTGGACCTCACCAGGCTCCTCAATGATATGCGGGCGCAGTATGAAACCATCGCT
GAGCAGAATCGGAAGGACGCTGAAGCCTGGTTCATTGAAAAG
gtaacacaaacaacaaaggctttgatacattcacagaaaggcctgcgaacgagctcagcg
ctcgagccccctggctgtctttgctgttgcagagcggggagctccgtaaggagattagca
ccaacaccgagcagcttcagtccagcaagagcgaggtcaccgacctgcgtcgcgcctttc
EXON 5  126 bp
caccaggctcctcaatgatatgcgggcgcagtatgaaaccatcgctgagcagaatcggaa
ggacgctgaagcctggttcattgaaaaggtaacacaaacaacaaaggctttgatacattc
acagaaaggcctgcgaacgagctcagcgctcgagccccctggctgtctttgctgttgcag
AGCGGGGAGCTCCGTAAGGAGATTAGCACCAACACCGAGCAGCTTCAGTCCAGCAAGAGC
GAGGTCACCGACCTGCGTCGCGCCTTTCAGAACCTGGAGATCGAGCTACAGTCCCAGCTC
GCCATG
gtaggctcgtgcgcaaacagacgtagcatcctttggacttccaaagaaaatgctgcatcc
aaattacattagccgttggctaccctcctcttttcggtcccctccatcgttatttctatg
ccatttccctcccacgtgcagaagaaatccctggaggactccttggccgaagccgagggc
EXON 6  221 bp
cagaacctggagatcgagctacagtcccagctcgccatggtaggctcgtgcgcaaacaga
cgtagcatcctttggacttccaaagaaaatgctgcatccaaattacattagccgttggct
accctcctcttttcggtcccctccatcgttatttctatgccatttccctcccacgtgcag
AAGAAATCCCTGGAGGACTCCTTGGCCGAAGCCGAGGGCGATTACTGCGCGCAGCTGTCC
CAGGTGCAGCAGCTCATCAGCAACCTGGAGGCACAGCTGCTCCAGGTGCGCGCGGACGCA
GAGCGCCAGAACGTGGACCACCAGCGGCTGCTGAATGTCAAGGCCCGCCTGGAGCTGGAG
ATTGAGACCTACCGCCGCCTGCTGGACGGGGAGGCCCAAGG
gtgagcagacaacggaggctgtaaacaccttcaggggctgaccaagagtgggcagcagaa
atagaaggaatggggttttagttgacagaaaagcaaacaaacaaacacaagtctagtaaa
gatatgcctgggatttactaaatgctctacactttgcaaagtgttttcacccattatctt
EXON 7  71 bp
aggacacatagtagccacctgaaccacctactctaacaagctttccaaaagtgatcagag
tctgcactagttggaagaactcaggcctacaaattgggaaatctaatttctcagaccaga
tcttccattaaaagccaggttgtttcactttttgaggtcatctcctttgttttcttacag
TGATGGTTTGGAGGAAAGTTTATTTGTGACAGACTCCAAATCACAAGCACAGTCAACTGA
TTCCTCTAAAG
gtatgcagaaaccctagaatcacttagaataagtcggaatcacatttattaatgcaaaac
ctgtaagacctcattgactactgcattattattaattttaatttaaagcatatttatatt
ctgagccaaggaaaaacatttatgcattcctgcacaaaatgagtagtctataccatatta
EXON 8  456 bp
gaatacatttcattgtcattggctaaaacacatttttgagaagtaaaatttacttttgaa
agtttaattagatggattgtatcaaccaatgcttaatttagaagcctacattaaacaacc
agtgttggattaatatttgaaacactaactcttgcccccttattccatttttatctttag
ACCCAACCAAAACCCGAAAAATCAAGACAGTTGTGCAGGAGATGGTGAATGGTGAGGTGG
TCTCATCTCAAGTTCAGGAAATTGAAGAACTAATGTAAAATTTCACAAGATCTGCCCCAT
GATTGGTTCCTTAGGAACAAGAAATTTACAAGTAGAAATTATTCCTTTCAGAGTAACATG
CTGTATTACTTCAATCCCTATTTTTGTCTGTTCCATTTTCTTTGGATTCCCTATTCACAT
TGAATCCTTTTTGCCCTTCTGAAACAATATTCAGTCACAAGTCATTTTGGTCATGTTGGT
CTTTGTAACAAATCAAAATTACCTTATATCCTTCTGGACCTGGAGTAGTCTTTTAACGAA
CTTTCTTCTGGTAACCCGGAATATTTTTTAATCATAGAGCTTTAATCAAGTAGTATTGTT
TTAATAGAGTTAATTGTAATAAAAGATGAATGGTAA
taatgtgaaatgtatgccttgattccaacaagaatgtcaagagcatagagagaagttttt
gaaatactactaataaaatagaggctgggagtaatgactcacacctataatcccagcact
ttgggaggctgagaggcaagatgattgcttgaggcccggagttcaagaccagcctggaca