Gene ITGB4 Variant 1
DNA : 36.38 KbNT_010641
mRNA : 5918 bp NM_000213
CDS : 5469 bp NP_000204
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  177 bp
cgccgctagccgatcggggcgctgggcgggcgccgcgggagccgcagccctttccggggg
gcggacccggctccggcggcggcacccagctcctgccccgacaggtgcgcgccgcgcgaa
ggaatgcagccggtctgactcaccagcgcctccttcctacctgcgcgcccgccccataaa
GCGCTGCCCGCCTCGTCCCCACCCCCCCAACCCCCGCGCCCGCCCTCGGACAGTCCCTGC
TCGCCCGCGCGCTGCAGCCCCATCTCCTAGCGGCAGCCCAGGCGCGGAGGGAGCGAGTCC
GCCCCGAGGTAGGTCCAGGACGGGCGCACAGCAGCAGCCGAGGCTGGCCGGGAGAGG
gtgagtgcccgccccagctgggcagccgcgcaggggagctggtcgggcagggccggtggc
ttttgtctccccttcccctccctgaaggctgacaggccccggtccctctgtccacgctgc
gcaggacaggtgcccagcctccccggggtgcgccgggggcagctggcagccaaggggcag
EXON 2  89 bp
aacagggcagcggaaaaggcaggagtccgaggcccagggccctgcctctggcggctgggc
gcccttggtcacattgttggtgctcagagcctcagttcccacagctgtgcagcgagagga
agctgacggcaccgaccatggctgtggaggcctcatgtgtcaattgttgctgttctgcag
GAGGAAGAGGATGGCAGGGCCACGCCCCAGCCCATGGGCCAGGCTGCTCCTGGCAGCCTT
GATCAGCGTCAGCCTCTCTGGGACCTTGG
gtgagtccacgttgccctgcagccccctcctggcaggatcatcccttgggcaggcattgc
ccttgcacggggatctcacggtgtctcacctaaacacgcttggccattcagcaactgacc
actgcccaccttcagggctggaaaacttgaggctccaagctcttcagcctagagaagctt
EXON 3  83 bp
gtgagccaggatcacgccactgcactccagcctgggcaacagagcgagactctgtctcaa
aataaataaataaataacataaggagggaatccccatctctccaggtgaaggtgcaggtg
ggaaagtgcttgcctttgctgagcgcctccccattcatgtgcccacatctgtccccccag
CAAACCGCTGCAAGAAGGCCCCAGTGAAGAGCTGCACGGAGTGTGTCCGTGTGGATAAGG
ACTGCGCCTACTGCACAGACGAG
gtgaggacctggcccgggttggtgtggaacaggcaagggtcgggaatagctggtggaaat
gaatctagggttggggcagccagggaatgggtgctgccccccagtgaccccctgtccttc
tggccagatgttcagggaccggcgctgcaacacccaggcggagctgctggccgcgggctg
EXON 4  102 bp
gctgcacggagtgtgtccgtgtggataaggactgcgcctactgcacagacgaggtgagga
cctggcccgggttggtgtggaacaggcaagggtcgggaatagctggtggaaatgaatcta
gggttggggcagccagggaatgggtgctgccccccagtgaccccctgtccttctggccag
ATGTTCAGGGACCGGCGCTGCAACACCCAGGCGGAGCTGCTGGCCGCGGGCTGCCAGCGG
GAGAGCATCGTGGTCATGGAGAGCAGCTTCCAAATCACAGAG
gtgcctggtgtggggactggggtgggggctccccatgctcagcctggctatttatggggg
tgtatagtgccccttggccgggctgggcccccatcgggcctccggagtgaccctctagcc
agctgtccccttccactggctgcaggagacccagattgacaccaccctgcggcgcagcca
EXON 5  205 bp
tcgtggtcatggagagcagcttccaaatcacagaggtgcctggtgtggggactggggtgg
gggctccccatgctcagcctggctatttatgggggtgtatagtgccccttggccgggctg
ggcccccatcgggcctccggagtgaccctctagccagctgtccccttccactggctgcag
GAGACCCAGATTGACACCACCCTGCGGCGCAGCCAGATGTCCCCCCAAGGCCTGCGGGTC
CGTCTGCGGCCCGGTGAGGAGCGGCATTTTGAGCTGGAGGTGTTTGAGCCACTGGAGAGC
CCCGTGGACCTGTACATCCTCATGGACTTCTCCAACTCCATGTCCGATGATCTGGACAAC
CTCAAGAAGATGGGGCAGAACCTGG
gtacggcagggccagagtggaggacagcagggcaggagggggacaggtgggcgtctgctt
gggaggccaggactcaggacagctgcacccacccagaaggaaacactggacatttgagcc
cccaaaaaccttcccttccattctcaagggaagaatctcggtcagaccctactcaccact
EXON 6  97 bp
cagtcccatttccctcatccataaataggaacagacaatgttgtgagcatgaacctttgt
ccagcatgcaaagcgttaacctccctcttcctcccttctgagccagcccttggtgggggg
cccgtgtttatgccaggcatcagggctcagctatcccctctctgtccttttgacatccag
CTCGGGTCCTGAGCCAGCTCACCAGCGACTACACTATTGGATTTGGCAAGTTTGTGGACA
AAGTCAGCGTCCCGCAGACGGACATGAGGCCTGAGAA
gtaagtgactgtgtgggtcccgcaggtgggcaagggtccaggccatgtgacccccactcc
tctttcacccacaacttaaaattatccttctacggctgggcacggtggctcatgcctgta
atcccagcactttgggagaccagggcgggcagatcacctgaggtcagaagttcaagacca
EXON 7  172 bp
gaggcagaggttgcagtgagccaagatcgtgcataccgcacaccagcctgggtgataaag
cgagacttggtctcaaaaaaaaaaaaaaaaattctccttctagttgaaacgagccagggg
cactggggtctgcggcgtcttccccctgtgacactctctctccctcccacctctgcccag
GCTGAAGGAGCCCTGGCCCAACAGTGACCCCCCCTTCTCCTTCAAGAACGTCATCAGCCT
GACAGAAGATGTGGATGAGTTCCGGAATAAACTGCAGGGAGAGCGGATCTCAGGCAACCT
GGATGCTCCTGAGGGCGGCTTCGATGCCATCCTGCAGACAGCTGTGTGCACG
gtgggcactgggaagggtgctgccagcctaggccaggggtgagcacttctgggcaagggc
ctgagctgccccctggcctgctctggtgccaggctcacaggccctgagggaaagcctggg
agcctgcaaccccttcaccctgagacaagctcagactctgtgagtaggtctcagttacaa
EXON 8  264 bp
ctcagcgttgtcactcagtcatgtgccgtcagatgcatctttcatgagggcacttgctgt
gaatccagtggcttaagcccagccccatgttgggacccgcgttccccgtcctacacgacg
ccgtgatgcgtgtcagcaggcagcctgctcagtgggcacgccccgccttgccttccccag
AGGGACATTGGCTGGCGCCCGGACAGCACCCACCTGCTGGTCTTCTCCACCGAGTCAGCC
TTCCACTATGAGGCTGATGGCGCCAACGTGCTGGCTGGCATCATGAGCCGCAACGATGAA
CGGTGCCACCTGGACACCACGGGCACCTACACCCAGTACAGGACACAGGACTACCCGTCG
GTGCCCACCCTGGTGCGCCTGCTCGCCAAGCACAACATCATCCCCATCTTTGCTGTCACC
AACTACTCCTATAGCTACTACGAG
gtgcggggcccaggtcccacgggtgggaggtggtcaaggtagggggtccatggagcttct
cagacacctctccctccctccctccctccctccctcccttcctcccttcctccctccctc
ttttcctccctttccttcctcccttcccaaagcctttagaccccccaaaatgtgggccct
EXON 9  90 bp
ggaggtcatgtgcccatcttccaccccaactcccaagcaggtgggggctaagagggcagg
ctctgcgacaccacagtaggttccaggcctcagtttccccatcctcaaagtgggaagaat
cctagagctgttcagattcatggagatgcttagcctgagacctggccttctctcccgcag
AAGCTTCACACCTATTTCCCTGTCTCCTCACTGGGGGTGCTGCAGGAGGACTCGTCCAAC
ATCGTGGAGCTGCTGGAGGAGGCCTTCAAT
gtgagggcagctcaggctccagagtctgagcccttctggggcagggcaggaagtgggcag
ggtgggcaagaggtgtcttggatcacggtggagaaatgggtctgggacagaccagtgagg
aagggtctctagctatccctgaggccccgaggggccacctgggcctggccctggctcctg
EXON 10  123 bp
ctgggacagaccagtgaggaagggtctctagctatccctgaggccccgaggggccacctg
ggcctggccctggctcctgcaggctctgtgataccccgcatgatgccagccacacttgga
ggttggggtggagcacagaggccccccacagagcactgatcaacctccttcctcctttag
CGGATCCGCTCCAACCTGGACATCCGGGCCCTAGACAGCCCCCGAGGCCTTCGGACAGAG
GTCACCTCCAAGATGTTCCAGAAGACGAGGACTGGGTCCTTTCACATCCGGCGGGGGGAA
GTG
gtacgcctctgtgggggcagcggggtgggggataggcacagcgccccacaccgagtggaa
tcgtttaaaacagcggtcaagagcgtggcccctggagtcaggcaggcctgggtgcagatc
cctgggcctagccgctcggatgagcctaggttgctcctctgcttgttggtttcctcggca
EXON 11  162 bp
cgctatgattgtgactgcgctgggaaggagggagtttccagccctgagggaggtgagcag
gagctcatttcagggatccagacatctcctaggaacttgggggccgagggccttcaggca
tcgatggccccctggtccttggggctgggcctgccttggctgaccacggggcccctgcag
GGTATATACCAGGTGCAGCTGCGGGCCCTTGAGCACGTGGATGGGACGCACGTGTGCCAG
CTGCCGGAGGACCAGAAGGGCAACATCCATCTGAAACCTTCCTTCTCCGACGGCCTCAAG
ATGGACGCGGGCATCATCTGTGATGTGTGCACCTGCGAGCTG
gtacaacgcagccccgcagggcgggaggggagagctgagccaagcacccagggaccctga
ggaatgaagcaggactcctgtgccccatatcccttgtggggtttcccgaggcacacagga
gagcggaagtgtccagtggccccggtcctgctcccccgacgcaccccaccatggtctctc
EXON 12  77 bp
agccccgcagggcgggaggggagagctgagccaagcacccagggaccctgaggaatgaag
caggactcctgtgccccatatcccttgtggggtttcccgaggcacacaggagagcggaag
tgtccagtggccccggtcctgctcccccgacgcaccccaccatggtctctctcattccag
CAAAAAGAGGTGCGGTCAGCTCGCTGCAGCTTCAACGGAGACTTCGTGTGCGGACAGTGT
GTGTGCAGCGAGGGCTG
gtgagtggggaagggagttgggcacccaggacaccagtggcccctgatgggaaagctggg
ctcctgcaggggcctggccctgggtgcaccttgtacacctggctgggggtggggcggcaa
tcaaagaaacggctaagggcggggcacacccagttgttggtcaaacccaggtcaaagcac
EXON 13  203 bp
caagaggcagagcttgcagtgagccaagatcgcgccactgcactccagcctgggcgacaa
ggcgagactccgtctcaaaaaaaaaaataaaataattaaattaaattaaattaaatggga
cagcaaaagccccagctttcctcctgggctgtttcggggaatgaccagttcctccttcag
GAGTGGCCAGACCTGCAACTGCTCCACCGGCTCTCTGAGTGACATTCAGCCCTGCCTGCG
GGAGGGCGAGGACAAGCCGTGCTCCGGCCGTGGGGAGTGCCAGTGCGGGCACTGTGTGTG
CTACGGCGAAGGCCGCTACGAGGGTCAGTTCTGCGAGTATGACAACTTCCAGTGTCCCCG
CACTTCCGGGTTCCTCTGCAATG
gtgagcacaacaactgcggccaatgctgatggcggggtagggagtggacagcaagcatga
ctttcccgtcaggacccaggttgggagagccagacttggaatcagaatccccaagttcag
gcccagcccactctggatgccctgagggccgcccctgagtcctgccccaacctgggcctg
EXON 14  104 bp
tggaggcagagatggagggaaggagattccaggaaagtgaggaagagatgacttctaccc
caggctagcggcaccctggctcccacagctctgttcccacaggccctccctgccaggtgg
gcagcctggactacaggcacagatgtagctctcatctcccttccttgtccctctctgcag
ACCGAGGACGCTGCTCCATGGGCCAGTGTGTGTGTGAGCCTGGTTGGACAGGCCCAAGCT
GTGACTGTCCCCTCAGCAATGCCACCTGCATCGACAGCAATGGG
gtaggcctgggcataagacagacagtgtctgtcagcaccacccaccctctccagagagaa
ccctatggagagaggagagggagcaggcagggatggggcacagctggctcactggtgccc
cctcctaccccagggcatctgtaatggacgtggccactgtgagtgtggccgctgccactg
EXON 15  99 bp
gctgtgactgtcccctcagcaatgccacctgcatcgacagcaatggggtaggcctgggca
taagacagacagtgtctgtcagcaccacccaccctctccagagagaaccctatggagaga
ggagagggagcaggcagggatggggcacagctggctcactggtgccccctcctaccccag
GGCATCTGTAATGGACGTGGCCACTGTGAGTGTGGCCGCTGCCACTGCCACCAGCAGTCG
CTCTACACGGACACCATCTGCGAGATCAACTACTCGGCG
gtgaggctaagacctacgaggtgtgggcgtgggaacagggcaggcacagggcagtgtggg
caggaggggctaagcctgatgccacaggagctggccaagggcaagaggtttggggagcgg
gggtctggcagaggcccacccaacacagtgcctgtctgccccgcctttccccgccaagat
EXON 16  130 bp
cggtgaggctaagacctacgaggtgtgggcgtgggaacagggcaggcacagggcagtgtg
ggcaggaggggctaagcctgatgccacaggagctggccaagggcaagaggtttggggagc
gggggtctggcagaggcccacccaacacagtgcctgtctgccccgcctttccccgccaag
ATCCACCCGGGCCTCTGCGAGGACCTACGCTCCTGCGTGCAGTGCCAGGCGTGGGGCACC
GGCGAGAAGAAGGGGCGCACGTGTGAGGAATGCAACTTCAAGGTCAAGATGGTGGACGAG
CTTAAGAGAG
gtaggggcaggggctgagggttggggttgctgagagcctaggcagcgggcatccaacggg
gcaagggtgtcatcacctggacgggggcttgcagtctgggctaaggtcacacagtccgga
caggaactccagagctgggagggaccacagaacccagatagaggacaccgaatcccagaa
EXON 17  123 bp
cccaccacacccgttcctgtgcctggtgagagcacggctttgcaaggacttccactcttc
cccaggaggccctgccgtgggtgaggcagatcgcagagtaggggccccctcaccagaccc
tgggtcctctggggcggaggggtgtggctggggtgccctgctgactggctgtgggtacag
CCGAGGAGGTGGTGGTGCGCTGCTCCTTCCGGGACGAGGATGACGACTGCACCTACAGCT
ACACCATGGAAGGTGACGGCGCCCCTGGGCCCAACAGCACTGTCCTGGTGCACAAGAAGA
AGG
gtgagctggtggggccgggcgcagggagggggcgtgtggccagagctcggtggggaggac
aggcaccacctccccctgcctcctcctctccagactgccctccgggctccttctggtggc
tcatccccctgctcctcctcctcctgccgctcctggccctgctactgctgctatgctgga
EXON 18  107 bp
aggatgacgactgcacctacagctacaccatggaaggtgacggcgcccctgggcccaaca
gcactgtcctggtgcacaagaagaagggtgagctggtggggccgggcgcagggagggggc
gtgtggccagagctcggtggggaggacaggcaccacctccccctgcctcctcctctccag
ACTGCCCTCCGGGCTCCTTCTGGTGGCTCATCCCCCTGCTCCTCCTCCTCCTGCCGCTCC
TGGCCCTGCTACTGCTGCTATGCTGGAAGTACTGTGCCTGCTGCAAG
gtgagcacccagggtgcctcccaaggccccacatcccagggtccccaccccaacagggcc
cccaccctccaccagggtccccagtccccgcctgagttctcatctccccagggtccccaa
ccccttcctgggtccccacctccccagggtccccatcccaacagggtccccatcctccac
EXON 19  34 bp
cccatccccctctatgcccttgtgtgccatgcttacaccctgctaccacctggatattct
ggtgtctggggaggcactgtcacccctcttgaccattggcatggggcggggtggctggaa
gggcttacctgggccagggcagctgtctcaggcctcaccctcacccaccttgtctcctag
GCCTGCCTGGCACTTCTCCCGTGCTGCAACCGAG
gtatgggcctggcatcgcaggggcagcaggggctctgactgctctttctctgagctgggg
tggagggaagctgaacctggaacggcagaggctggaggctctggggtcccacctgaagag
gttgggctgtgcgggtctagggaggggtgccgtgctgaggaccccatcctgcaggtcaca
EXON 20  192 bp
accgaggtatgggcctggcatcgcaggggcagcaggggctctgactgctctttctctgag
ctggggtggagggaagctgaacctggaacggcagaggctggaggctctggggtcccacct
gaagaggttgggctgtgcgggtctagggaggggtgccgtgctgaggaccccatcctgcag
GTCACATGGTGGGCTTTAAGGAAGACCACTACATGCTGCGGGAGAACCTGATGGCCTCTG
ACCACTTGGACACGCCCATGCTGCGCAGCGGGAACCTCAAGGGCCGTGACGTGGTCCGCT
GGAAGGTCACCAACAACATGCAGCGGCCTGGCTTTGCCACTCATGCCGCCAGCATCAACC
CCACAGAGCTGG
gtgagggcggggctgggcgccacagctctgggcagtgcccttcgggccctctgttccaga
tctgggatcacagcatgcctcttctctgggtgtggggtgcaggcacagggctcagccacc
ttttgccctgtgctgatggtgctatgaacctcatgcctcggtgtgcgtggcctgctggcc
EXON 21  104 bp
agggctcagccaccttttgccctgtgctgatggtgctatgaacctcatgcctcggtgtgc
gtggcctgctggccaggcatcccctgatcctagcatggttgctggagggatgctctgtgg
tgcctgtcatgcagggggctgaccacctccatctcaccccctcccaccgcctttccttag
TGCCCTACGGGCTGTCCTTGCGCCTGGCCCGCCTTTGCACCGAGAACCTGCTGAAGCCTG
ACACTCGGGAGTGCGCCCAGCTGCGCCAGGAGGTGGAGGAGAAC
gtaaggacccaggaactaggcctggccggagatgtgggtatgagggcgggtgaggtgggc
agggcagagcgaatgcggtcgtggtaccgagattcattaactaggggagaggggtctctc
tggacctgtgcctggcagggggcatcctgggatctgtttccagagggcagaaggccagag
EXON 22  59 bp
atctgtttccagagggcagaaggccagagcctgggcccaggatgctgccccacggggcat
gccccagccaaccctgaggatctctgggtacagaggctgcctggctccctgggtccccag
cctgagggcttgccacggggtggcctaggcccagcctcacgcccctcccttgcctggcag
CTGAACGAGGTCTACAGGCAGATCTCCGGTGTACACAAGCTCCAGCAGACCAAGTTCCG
gtgagtcccggggtgcccgggttgggtgggggagccgctcctaccgggactccaggagcc
gaagcccccaggccgatcaggcctccacttcagggctatctagctcacagcgccctcttt
gtccccacaggcagcagcccaatgccgggaaaaagtgagtagaagactcgtgggtgagag
EXON 23  24 bp
gtctacaggcagatctccggtgtacacaagctccagcagaccaagttccggtgagtcccg
gggtgcccgggttgggtgggggagccgctcctaccgggactccaggagccgaagccccca
ggccgatcaggcctccacttcagggctatctagctcacagcgccctctttgtccccacag
GCAGCAGCCCAATGCCGGGAAAAA
gtgagtagaagactcgtgggtgagagggcccccacttcctgcccgcctgtccccagccca
gccactgcctcgtccgtccctactccatctccatcccataggaagggagggtcagatgtg
tccgtcaggttcggaccttcattcgttcctttgaccatttcttcaacaaatgctaatgtg
EXON 24  149 bp
ggctgcagggtaaagggtatggggctggcataggcctggagcactgcctgcctctgaaga
ccctgcacttcttgctgtcttacatcctggcccctgaaggggagaagacaggcaggaggg
acagggcagcaggtgccagcctgacccctccgctgcctgaaccttccaccctcgacccag
GCAAGACCACACCATTGTGGACACAGTGCTGATGGCGCCCCGCTCGGCCAAGCCGGCCCT
GCTGAAGCTTACAGAGAAGCAGGTGGAACAGAGGGCCTTCCACGACCTCAAGGTGGCCCC
CGGCTACTACACCCTCACTGCAGACCAGG
gtaggagggcgggtccgctgtgccactgcctcgcacctcccgcctgtgtggccctgtgac
ccacctctgaccacctccgaacccccacccagacgcccggggcatggtggagttccagga
gggcgtggagctggtggacgtacgggtgcccctctttatccggcctgaggatgacgacga
EXON 25  180 bp
ctgaagcttacagagaagcaggtggaacagagggccttccacgacctcaaggtggccccc
ggctactacaccctcactgcagaccagggtaggagggcgggtccgctgtgccactgcctc
gcacctcccgcctgtgtggccctgtgacccacctctgaccacctccgaacccccacccag
ACGCCCGGGGCATGGTGGAGTTCCAGGAGGGCGTGGAGCTGGTGGACGTACGGGTGCCCC
TCTTTATCCGGCCTGAGGATGACGACGAGAAGCAGCTGCTGGTGGAGGCCATCGACGTGC
CCGCAGGCACTGCCACCCTCGGCCGCCGCCTGGTAAACATCACCATCATCAAGGAGCAAG

gtgggtctgggtggggagagtggggaaggcagacgggggctcgggggcactggttcctcc
tgcttaagtggaattgcgacctggccacgtggcctgggctagtcacttaacctctgcaag
ccttggtttctccatctgtaaaatgggtaagggctcttttacggaatgcgtggctgttca
EXON 26  149 bp
cctcatctttttctggaaggattttccgtttcgctcctgtgcccttcccagagggcaatg
catagagggaaccaagcggactcctggattctgggctgggctgggcagggtcacaggaga
gcaggaggtgggaagggactgggcccagcacactctgacaaatgcccgggctccttgcag
CCAGAGACGTGGTGTCCTTTGAGCAGCCTGAGTTCTCGGTCAGCCGCGGGGACCAGGTGG
CCCGCATCCCTGTCATCCGGCGTGTCCTGGACGGCGGGAAGTCCCAGGTCTCCTACCGCA
CACAGGATGGCACCGCGCAGGGCAACCGG
gtgaggctgcgccacagggtcgagggtgcagcccggggggctgcgtgggcaccgcattgg
gttcccaagacaaagcagcacatggcagctgcttgagtccctggatactggccgtgcccc
tggctggcctcccaaggacacgtccacctgctcctgccaccctgtggcaggggagtctca
EXON 27  205 bp
ttacgcctcaaaaaaaaaaacaaacaaaaaaaacacaaaaacctgaacctcgtgtaagta
ctccacccagcaagcagggatggtctctgcagtgtccatgaggttgggagggagcgtgtg
gccatgactcttgcctcagcccccagccatgaccctgaccctgaccccctccactcccag
GACTACATCCCCGTGGAGGGTGAGCTGCTGTTCCAGCCTGGGGAGGCCTGGAAAGAGCTG
CAGGTGAAGCTCCTGGAGCTGCAAGAAGTTGACTCCCTCCTGCGGGGCCGCCAGGTCCGC
CGTTTCCACGTCCAGCTCAGCAACCCTAAGTTTGGGGCCCACCTGGGCCAGCCCCACTCC
ACCACCATCATCATCAGGGACCCAG
gtaggcagagcctgggggtcggcttaagcaggaggagagggaagactggggggtctctca
actaggtctgtcagacttagcaaatccaaacacaggacgcccaggtaaatctgaatttca
ggtaaacaacatacacgttggtaggataagtatgtcccatgcaatatttggaacatactt
EXON 28  158 bp
gcttggcaggatgctctatgtggcagcaatggggcaccaccaggtctccagagacgcggg
tgggcaggtctgagttgaatgcgctgggtagagcgccctgggtgttgaagtgggtctctg
gcgccccctggtggtgaagggggatctgagtggttgcccggccccaacctgacccgttag
ATGAACTGGACCGGAGCTTCACGAGTCAGATGTTGTCATCACAGCCACCCCCTCACGGCG
ACCTGGGCGCCCCGCAGAACCCCAATGCTAAGGCCGCTGGGTCCAGGAAGATCCATTTCA
ACTGGCTGCCCCCTTCTGGCAAGCCAATGGGGTACAGG
gtaaggcggggggctgagggtcacgacaggtggatgggcggtctggcaccagcactcaca
gaagaggtgggccgtccaaggccagggccccctgagagagagcagacagtggaacctagc
acaggtggtcagagggaaacccggtctgtgctgggaaagagggaagacccattcctgagt
EXON 29  181 bp
atgggagatacccccacctgctctgccctagtcctgacgtgtgcacatggcagatctctc
agcccctccctcgggcctcatctgtgcaaagaggacagtaagggcagaggtcagaggagg
gacaggcagcttgggtgcctgctgctccctgctgaccaggacccctgtccctgggggtag
GTAAAGTACTGGATTCAGGGTGACTCCGAATCCGAAGCCCACCTGCTCGACAGCAAGGTG
CCCTCAGTGGAGCTCACCAACCTGTACCCGTATTGCGACTATGAGATGAAGGTGTGCGCC
TACGGGGCTCAGGGCGAGGGACCCTACAGCTCCCTGGTGTCCTGCCGCACCCACCAGGAA
G
gtgaggcctcgccatgtctgtccatttgtcccctggctgccctgatgccagcatgcccag
acctccctccctctgccactgacagcactcttcctgtattccccgctccctagtgcccag
cgagccagggcgtctggccttcaatgtcgtctcctccacggtgacccagctgagctgggc
EXON 30  138 bp
tgcgcctacggggctcagggcgagggaccctacagctccctggtgtcctgccgcacccac
caggaaggtgaggcctcgccatgtctgtccatttgtcccctggctgccctgatgccagca
tgcccagacctccctccctctgccactgacagcactcttcctgtattccccgctccctag
TGCCCAGCGAGCCAGGGCGTCTGGCCTTCAATGTCGTCTCCTCCACGGTGACCCAGCTGA
GCTGGGCTGAGCCGGCTGAGACCAACGGTGAGATCACAGCCTACGAGGTCTGCTATGGCC
TGGTCAACGATGACAACC
gtaagaaccagatccttctttcctgcccacagggagaacagccatggaaggggaggggac
aaagctggagggagctcttggtcactccctggacctgctgtgcagggcactcgaggcctt
catcctggtcagcggataagcctgaggcatctttagggttttggccagatttgggctggg
EXON 31  183 bp
cgccagtcatgctgacgctcagggctccgcaggcggcaattcagcagtggctggctttgc
cttgcttccccagcccctgggtgccatccaggggatgcacggccgtcctgctgtgtcagg
ggtggtgttgggaccaggctgggacctgggtgaccctctgaagcactctctctgccccag
GACCTATTGGGCCCATGAAGAAAGTGCTGGTTGACAACCCTAAGAACCGGATGCTGCTTA
TTGAGAACCTTCGGGAGTCCCAGCCCTACCGCTACACGGTGAAGGCGCGCAACGGGGCCG
GCTGGGGGCCTGAGCGGGAGGCCATCATCAACCTGGCCACCCAGCCCAAGAGGCCCATGT
CCA
gtgagtggtgggcagggaggtgaggggcagaccgggcaggggggcagggggcagcagcca
gggccctggctcactcccctgccctgcagtccccatcatccctgacatccctatcgtgga
cgcccagagcggggaggactacgacagcttccttatgtacagcgatgacgttctacgctc
EXON 32  132 bp
tacacggtgaaggcgcgcaacggggccggctgggggcctgagcgggaggccatcatcaac
ctggccacccagcccaagaggcccatgtccagtgagtggtgggcagggaggtgaggggca
gaccgggcaggggggcagggggcagcagccagggccctggctcactcccctgccctgcag
TCCCCATCATCCCTGACATCCCTATCGTGGACGCCCAGAGCGGGGAGGACTACGACAGCT
TCCTTATGTACAGCGATGACGTTCTACGCTCTCCATCGGGCAGCCAGAGGCCCAGCGTCT
CCGATGACACTG
gtgagtggagacctgggacccacaagaggacagtgggggtcttgggtacagagtgagtcc
actgggtccagagagggcaaaggggccagcaactagaggacatggaggttaaggcagcct
tggacaaatgcaatggagtgcacatctgtgcatggggcacaggaaccagtgcctggggga
EXON 33  210 bp
tcacctgccgcggccttcccgctccggccgtgcgcatctacccccgcccccaacacacac
cccgggatcccgggagctggagacgggctcccctcgcagagcctacggccttcccccgcc
tggccctgctcggcccggcgccccccggcggtgccaacgcggcccttcgttgttcccaag
GCTGCGGCTGGAAGTTCGAGCCCCTGCTGGGGGAGGAGCTGGACCTGCGGCGCGTCACGT
GGCGGCTGCCCCCGGAGCTCATCCCGCGCCTGTCGGCCAGCAGCGGGCGCTCCTCCGACG
CCGAGGCGCCCCACGGGCCCCCGGACGACGGCGGCGCGGGCGGGAAGGGCGGCAGCCTGC
CCCGCAGTGCGACACCCGGGCCCCCCGGAG
gtgacaggctcacccgccgccccccgatccgcgcccacccagcctcactcgcgcctgagg
gcctggggtgggcgtctgcgctgcctcgggggccccagtttcagccaggcccgggccttg
gcggctgggagcacagctgctcagaggcagggcccagtgccaggggacgcgtgaggcagg
EXON 34  240 bp
ggcccttgggctcctgcagggacagagggcctctgtccctagtggtttgagggaaactgg
ttgtatttaagcaaaagccacccagagggtgggtgaccaggaatgtgcagggcccagcct
gccccacggggcccgggtctggggcaggcctgaccaagggaccctgctctccccctgcag
AGCACCTGGTGAATGGCCGGATGGACTTTGCCTTCCCGGGCAGCACCAACTCCCTGCACA
GGATGACCACGACCAGTGCTGCTGCCTATGGCACCCACCTGAGCCCACACGTGCCCCACC
GCGTGCTAAGCACATCCTCCACCCTCACACGGGACTACAACTCACTGACCCGCTCAGAAC
ACTCACACTCGACCACACTGCCCAGGGACTACTCCACCCTCACCTCCGTCTCCTCCCACG

gtgagtgacctcagccaaccctgcctctcccactaacccttcctctcttccagctcctgg
agcctcgggcttctgtctgctgtccccaccgcccattctccaacatacacacacgcatgc
acacatgcacgcacacacgtgcacacgcatgcacacatgtacacagacatgcatgcgcac
EXON 35  150 bp
tggaggatgtgcggtaggtgctgggcagcctggacagggtgttgcagggtgagtgagttg
tccagccagcggtcagtgtagacatgccagctgagggagggaggtcagggggcagcactg
tgactcccactgagaccctagcccctgcatctctggctgactgcggcctcctgtccccag
ACTCTCGCCTGACTGCTGGTGTGCCCGACACGCCCACCCGCCTGGTGTTCTCTGCCCTGG
GGCCCACATCTCTCAGAGTGAGCTGGCAGGAGCCGCGGTGCGAGCGGCCGCTGCAGGGCT
ACAGTGTGGAGTACCAGCTGCTGAACGGCG
gtgaggcatggtggctgccaggctgcggggtgcagccctgcaaggcctggccccagtgtg
acacatagggtacctcagctgtgtcaggaacccacccaagtcccttgagcgctaaagccc
ccatccagcctgagagggtctcccaccccattctccaccccacttctttgcctcccctct
EXON 36  189 bp
cttgtatagtacacaatctgaacaaccagccataccatactgtacccaacctgtacccaa
accacagctagtcctgggtgggtgataactaggtctcgatggcagcttagggacgaggag
gatcaggccaggggtgggagtaacactgcactactgtgtgcccccacctgatccccccag
GTGAGCTGCATCGGCTCAACATCCCCAACCCTGCCCAGACCTCGGTGGTGGTGGAAGACC
TCCTGCCCAACCACTCCTACGTGTTCCGCGTGCGGGCCCAGAGCCAGGAAGGCTGGGGCC
GAGAGCGTGAGGGTGTCATCACCATTGAATCCCAGGTGCACCCGCAGAGCCCACTGTGTC
CCCTGCCAG
gtgagttgcctcccccagccccagagctgcccccatcatgcccaccacccacccacaggc
tgatgctcttcctctactgcccccaggctccgccttcactttgagcactcccagtgcccc
aggcccgctggtgttcactgccctgagcccagactcgctgcagctgagctgggagcggcc
EXON 37  156 bp
gcccagagccaggaaggctggggccgagagcgtgagggtgtcatcaccattgaatcccag
gtgcacccgcagagcccactgtgtcccctgccaggtgagttgcctcccccagccccagag
ctgcccccatcatgcccaccacccacccacaggctgatgctcttcctctactgcccccag
GCTCCGCCTTCACTTTGAGCACTCCCAGTGCCCCAGGCCCGCTGGTGTTCACTGCCCTGA
GCCCAGACTCGCTGCAGCTGAGCTGGGAGCGGCCACGGAGGCCCAATGGGGATATCGTCG
GCTACCTGGTGACCTGTGAGATGGCCCAAGGAGGAG
gtgctgcccaccccgggggcaggagtggccaggggaggggtaaagagggggccgcagacg
ctgaaggcatcttccctgctcagggccagccaccgcattccgggtggatggagacagccc
cgagagccggctgaccgtgccgggcctcagcgagaacgtgccctacaagttcaaggtgca
EXON 38  165 bp
agcccagactcgctgcagctgagctgggagcggccacggaggcccaatggggatatcgtc
ggctacctggtgacctgtgagatggcccaaggaggaggtgctgcccaccccgggggcagg
agtggccaggggaggggtaaagagggggccgcagacgctgaaggcatcttccctgctcag
GGCCAGCCACCGCATTCCGGGTGGATGGAGACAGCCCCGAGAGCCGGCTGACCGTGCCGG
GCCTCAGCGAGAACGTGCCCTACAAGTTCAAGGTGCAGGCCAGGACCACTGAGGGCTTCG
GGCCAGAGCGCGAGGGCATCATCACCATAGAGTCCCAGGATGGAG
gtaggcacctgtcctttccttcacccccacccctcctcgggccgtgcctccttctggcac
caccctctgactggcctatctgcccaccccaggacccttcccgcagctgggcagccgtgc
cgggctcttccagcacccgctgcaaagcgagtacagcagcatcaccaccacccacaccag
EXON 39  111 bp
ccctacaagttcaaggtgcaggccaggaccactgagggcttcgggccagagcgcgagggc
atcatcaccatagagtcccaggatggaggtaggcacctgtcctttccttcacccccaccc
ctcctcgggccgtgcctccttctggcaccaccctctgactggcctatctgcccaccccag
GACCCTTCCCGCAGCTGGGCAGCCGTGCCGGGCTCTTCCAGCACCCGCTGCAAAGCGAGT
ACAGCAGCATCACCACCACCCACACCAGCGCCACCGAGCCCTTCCTAGTGG
gtgagcactgagggctaggggatcccggctctcctgggacagggagctagcagagggaga
agggcagaccccaagccaggtcatctaatgcctcctcctccacagatgggctgaccctgg
gggcccagcacctggaggcaggcggctccctcacccggcatgtgacccaggagtttgtga
EXON 40  402 bp
tccagcacccgctgcaaagcgagtacagcagcatcaccaccacccacaccagcgccaccg
agcccttcctagtgggtgagcactgagggctaggggatcccggctctcctgggacaggga
gctagcagagggagaagggcagaccccaagccaggtcatctaatgcctcctcctccacag
ATGGGCTGACCCTGGGGGCCCAGCACCTGGAGGCAGGCGGCTCCCTCACCCGGCATGTGA
CCCAGGAGTTTGTGAGCCGGACACTGACCACCAGCGGAACCCTTAGCACCCACATGGACC
AACAGTTCTTCCAAACTTGACCGCACCCTGCCCCACCCCCGCCACGTCCCACTAGGCGTC
CTCCCGACTCCTCTCCCGGAGCCTCCTCAGCTACTCCATCCTTGCACCCCTGGGGGCCCA
GCCCACCCGCATGCACAGAGCAGGGGCTAGGTGTCTCCTGGGAGGCATGAAGGGGGCAAG
GTCCGTCCTCTGTGGGCCCAAACCTATTTGTAACCAAAGAGCTGGGAGCAGCACAAGGAC
CCAGCCTTTGTTCTGCACTTAATAAATGGTTTTGCTACTGCT
aggccctgccttgcccattcttctggggcctgagaggtgctcccctagggtaggggagcg
gttctgacatcccccattctctgacacccaagcatacacccacctctagaggaggcaggt
accacattggaggcacaagtttattgagcacccggatatggaagatggcaccgggcacag