Gene HOXB4 Variant 1
DNA : 1.93 KbNT_010783
mRNA : 1093 bp NM_024015
CDS : 756 bp NP_076920
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  529 bp
cctggtgttgggtgggtgggtggggagggggaagggaagaaggggaaataaacctctttg
gctggagtggggtccgggtgagcagatttccttatccgggaatcgcaggcggggcggcca
ttggctcggaggatcacgtgggcgcctaactttgttcacttgacagtaagtaggagggct
TTCGGAAACAGGAAAACGAGTCAGGGGTCGGAATAAATTTTAGTATATTTTGTGGGCAAT
TCCCAGAAATTAATGGCTATGAGTTCTTTTTTGATCAACTCAAACTATGTCGACCCCAAG
TTCCCTCCATGCGAGGAATATTCACAGAGCGATTACCTACCCAGCGACCACTCGCCCGGG
TACTACGCCGGCGGCCAGAGGCGAGAGAGCAGCTTCCAGCCGGAGGCGGGCTTCGGGCGG
CGCGCGGCGTGCACCGTGCAGCGCTACGCGGCCTGCCGGGACCCTGGGCCCCCGCCGCCT
CCGCCACCACCCCCGCCGCCCCCGCCACCGCCCGGTCTGTCCCCTCGGGCTCCTGCGCCG
CCACCCGCCGGGGCCCTCCTCCCGGAGCCCGGCCAGCGCTGCGAGGCGGTCAGCAGCAGC
CCCCCGCCGCCTCCCTGCGCCCAGAACCCCCTGCACCCCAGCCCGTCCCACTCCGCGTGC
AAAGAGCCCGTCGTCTACCCCTGGATGCGCAAAGTTCACGTGAGCACGG
gtgagtgcgtgggcaccccttccccctcccacccctggagctttacaccaaagggacttc
ggaggcatgggttgggggggggttgagctggggaagccaattgtccccgctataaactcg
ccattgccggagatttacggtcgcctgttttcagagccacataattacatcccccataaa
EXON 2  564 bp
tctctttctcattcttgggtcttgcattcttcccttttcgtttttccccgctctccctca
gaaggaagaagaggtggcgggagagggagggagggaaacgctgtgttccctggaagaaag
gactctctctttcgggggcaataaaactttctctttctccctctctccgtgtgtgtccag
TAAACCCCAATTACGCCGGCGGGGAGCCCAAGCGCTCTCGGACCGCCTACACGCGCCAGC
AGGTCTTGGAGCTGGAGAAGGAATTTCACTACAACCGCTACCTGACACGGCGCCGGAGGG
TGGAGATCGCCCACGCGCTCTGCCTCTCCGAGCGCCAGATCAAGATCTGGTTCCAGAACC
GGCGCATGAAGTGGAAAAAAGACCACAAGTTGCCCAACACCAAGATCCGCTCGGGTGGTG
CGGCAGGCTCAGCCGGAGGGCCCCCTGGCCGGCCCAATGGAGGCCCCCGCGCGCTCTAGT
GCCCCCGCACGCGGGAGCCACGAACCTCGGGGTGGGGGTGGGCAGTGAGTGCAGGGGATG
GGGTGGGGGGACAGGAGGGGGCCCTGGGGCCTGGGCCCCGGAAAAATCTATCTGCCCTCC
CCCACACTTTATATACGAATAAACGCAGAAGAGGGGGAGGGGAAGCTTTATTTATAGAAA
TGACAATAGAGGGCCACGGGGAGGCCCCCCCAGAAGCAAGATTCAAATCTCTTGCTTTCT
TTCTTAAAAAAAAGAAAAAGAAAA
agcaagaagaaggaagaaagaaaaagacagaaagagaaataggaggaggctgcagctcct
cgttttcagctttggcgaagatggatccacgtttcatctttaatcacgccaggtccaggc
ccatctgtcttgtttcctctgccgaggagaagacgggcctcggtggcgaccattacctcg