Gene GIP Variant 1
DNA : 10.04 KbNT_010783
mRNA : 711 bp NM_004123
CDS : 462 bp NP_004114
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  77 bp
gagatagccaaatgttaatcaccaattagcacagttcaggtggaaagggcaactctatta
tgtgtaaaatggacttaatgtggcaggagctgtgggcttaatttcttgagataagatgct
tttaggctaatcagcaggtctatgcctaatataaaggagctggggcatgatttcttcagc
AGGCTCAGAAGGTCCAGAAATCAGGGGAAGGAGACCCCTATCTGTCCTTCTTCTGGAAGA
GCTGGAAAGGAAGTCTG
gtaagagaagtggagacagggatggatgagatgacccgagagcagatggatcttggcaac
cctgagatgctcagcagccctggcatcttagttttctcttcctctatatgagatgtgaga
agatagtcaggtgcggtgcctcatgcctgtaatcccaatactttgggagccgaggtagga
EXON 2  107 bp
gagccaagattgtgccactgcactcccacctggacgacagagcgagactccatctcaaaa
aaaaaaaaaaaaaagaaaaaggaaaagaaagggtccaaacctcagggctttgcccctctc
cagctttcagaacccctactggttgctctctcaacatgtcctggcttttttctgtcttag
CTCAGGAAATAACCTTGGAAGATGGTGGCCACGAAGACCTTTGCTCTGCTGCTGCTGTCC
CTGTTCCTGGCAGTGGGACTAGGAGAGAAGAAAGAGGGTCACTTCAG
gtaggagtggtgagaggaaagggatggggcagaggaggggttaggggatgacaggttctg
gatttgtttctagggggagatgagaaagggaaggaatccaggctaagaggtaggaagctc
cagggaaatacctgccggcagcgtgagtgcaaagtgagcactgagccagagaggatttat
EXON 3  171 bp
agtgggccctggagctgaggataaagcctggggtggggtgggggagtggatccacaggga
gtctccataaaaacggactggtttgttttcaagtgtctgcctcctgttagtgacagtcat
ttaccctagcattgtgattctccccccatctctgccccttctccgcacccttgtttccag
CGCTCTCCCCTCCCTGCCTGTTGGATCTCATGCTAAGGTGAGCAGCCCTCAACCTCGAGG
CCCCAGGTACGCGGAAGGGACTTTCATCAGTGACTACAGTATTGCCATGGACAAGATTCA
CCAACAAGACTTTGTGAACTGGCTGCTGGCCCAAAAGGGGAAGAAGAATGA
gtgagtcgctgcttacactcctcctgttccctgtgccgggctctgccttcctaccttcag
aggaggccaccggctgtggccacacaggccacatgatgcacaaccccaggtggcaccttt
ctttttcttttcttttttttttttttttttgagatggagtctcactctttcgcccaggct
EXON 4  93 bp
tggtcagcacggtagattctgaaaagctgttcactggtggaggcagctgaagaccactgt
taggtggggttgagtggaaaaaggtaccctctgcttttggggttcagatattaaaagatt
caagtgtccctagactggagtctccgcagcttgcccactctctaatctttatcttcccag
CTGGAAACACAACATCACCCAGAGGGAGGCTCGGGCGCTGGAGCTGGCCAGTCAAGCTAA
TAGGAAGGAGGAGGAGGCAGTGGAGCCACAGAG
gtgagtcagggcgcagagggaagggagggagccaagcctcctgccccgcccccacctctt
tgttccctctccctgaccccagagcagagcaaggacctgagataagcatcctcttcctct
cagagttcaaagaggggtcttcattgagcaaactcctggaggtcagcccaagcttaagga
EXON 5  102 bp
gctgggtggggctggcagaaaggaggctccagatctcagagctgagccaacggagagata
gctgtgtcggctccctccccccatccgcggctgcccctcagtggtgtccccaaccctgtg
tttaccctctctgggcgaagctcaggctaaaatagttagccagagactgttcccttgcag
CTCCCCAGCCAAGAACCCCAGCGATGAAGATTTGCTGCGGGACTTGCTGATTCAAGAGCT
GTTGGCCTGCTTGCTGGATCAGACAAACCTCTGCAGGCTCAG
gtaggggagtgtggtgttgcacagcggttctaacttgagcttgggcatcagacatggatt
cagatctttgcccctccacatgctggctgattacatagcctttctgaacctcagtgtttt
cactaaaatcagaggtatagaatcatttcacaggattgttgtcagctttaagtaagagaa
EXON 6  161 bp
ggcgacagagcgagactccgtctcaaaaaaaaaaaaaaaagtaaattgataaaaattaaa
atatttaaaaaggtgatttgaaggtaggaggggttcaacaatggttgggtcccaggataa
atgtgcttggccgactccaagtccataacaaccttcttctcctttccccactctccccag
GTCTCGGTGACTCTGACCACACCCAGCTCAGGACTGGATTCTGCCCTTCACTTAGCACCT
GCCTCAGCCCCACTCCAGAATAGCCAAGAGAACCCAAACCAATAAAGTTTATGCTAAGTC
GAGCCCATTGTGAAAATTTATTAAAATGACTACTGAGCACT
aacagggcatgtttgtctttgtgtatctctgtgtgtgggcaccacccaatgaaaaggaaa
tatggtctgggcatggtggcatatgcctgtaatcccagtactctgggaggctgagtctgg
aggattcgcttaaccccagaagttcgagactaacctgggtaacagagtgagaccccatct