Gene G6PC Variant 1
DNA : 12.57 KbNT_010755
mRNA : 3096 bp NM_000151
CDS : 1074 bp NP_000142
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  309 bp
tgtgtgcctgtttttctattttacgtaaatcaccctgaacatgtttgcatcaacctactg
gtgatgcacctttgatcaatacattttagacaaacgtggtttttgagtccaaagatcagg
gctgggttgacctgaatactggatacagggcatataaaacaggggcaaggcacagactca
TAGCAGAGCAATCACCACCAAGCCTGGAATAACTGCAAGGGCTCTGCTGACATCTTCCTG
AGGTGCCAAGGAAATGAGGATGGAGGAAGGAATGAATGTTCTCCATGACTTTGGGATCCA
GTCAACACATTACCTCCAGGTGAATTACCAAGACTCCCAGGACTGGTTCATCTTGGTGTC
CGTGATCGCAGACCTCAGGAATGCCTTCTACGTCCTCTTCCCCATCTGGTTCCATCTTCA
GGAAGCTGTGGGCATTAAACTCCTTTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGT
CTTTAAGTG
gtaagaaccatatagagaggagatcagcaagaaaagaggctggcattcgctctcgcaatg
tctgtccatcagaagttgctttccccaggctattcaggaagccacgggctactcatgctt
ccaacccctctctctgactttggatcatctacataaagggggaagacagaaaaaatccta
EXON 2  110 bp
ttacatacataaggaagtgtcatgaaatatctccctctcacacttctccccagccaccca
gttctcccttctagaggcaacatgtgaaatccttctcaggctacactcttcttgaaggtg
taggctttgggcaaaagcattcattcagtaaccccagaaacttgttctgtttttccatag
GATTCTCTTTGGACAGCGTCCATACTGGTGGGTTTTGGATACTGACTACTACAGCAACAC
TTCCGTGCCCCTGATAAAGCAGTTCCCTGTAACCTGTGAGACTGGACCAG
gtaagcgtcccagcccctgcagacagaagctgagtggacctcgtttacctgttatggatg
aaactgaccttgaggggacatgaggagagccattcctttgtacttttgtcatgctcttca
attggcacaaattaattcacttctgcaatactttcctgaatagcacagtagtattggaaa
EXON 3  106 bp
aacgaatggatggtaagatgggtggatggatggggggtgaacggatggatggggggtgaa
tggatggatgaatgggtagatgggtggatagggggatggctgggtggctgggtagatgat
gcactgtctcccagatgaggaccttttcacctttactccattctctttcctgccctttag
GGAGCCCCTCTGGCCATGCCATGGGCACAGCAGGTGTATACTACGTGATGGTCACATCTA
CTCTTTCCATCTTTCAGGGAAAGATAAAGCCGACCTACAGATTTCG
gtaagaactcaccactggggtgtaggtggtggagggcaggaggcagctctctctgtagct
gacacaccacgtattcttcctcacatccccctagcccgctcccacacctgggcagccgct
gattaagagttgtggcactttggatagggataaacctcagagtcagggaatgtttgggct
EXON 4  116 bp
tctgagccgctgcacccagcccccaacaggcatctttggacttttgagtactggctttaa
tttacaaaaattccactgagagcacctaagtttgccaggctccaacatttctgcaggggc
tgttttctttgctgaaggatctgcacctgtgttctgttatggttgcctcttctgttgcag
GTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGGCTGTGCAGCTGAATGTCTGTCTGTC
ACGAATCTACCTTGCTGCTCATTTTCCTCATCAAGTTGTTGCTGGAGTCCTGTCAG
gtatgggctgatctgactcccttccttctcccccaaaccccattccgtttctctccctaa
tcaggacaaaatcccagcattccagccacatcctgtgtgtaatcagtactgttagcattt
ctgtgggttgaaagtcaagaatgagcaacttgaaatgattaatttctataagagtgccca
EXON 5  2455 bp
tatattgagggcaggctggagtcacacatgggaataagccaggcgaccctcccatctgcc
atctgtgatttaattccacagtcgcagaacggatggcatgtcacccactcctccaaaccc
acctctagcaaaggtcccaaatccttcctatctctcacagtcatgctttcttccactcag
GCATTGCTGTTGCAGAAACTTTCAGCCACATCCACAGCATCTATAATGCCAGCCTCAAGA
AATATTTTCTCATTACCTTCTTCCTGTTCAGCTTCGCCATCGGATTTTATCTGCTGCTCA
AGGGACTGGGTGTAGACCTCCTGTGGACTCTGGAGAAAGCCCAGAGGTGGTGCGAGCAGC
CAGAATGGGTCCACATTGACACCACACCCTTTGCCAGCCTCCTCAAGAACCTGGGCACGC
TCTTTGGCCTGGGGCTGGCTCTCAACTCCAGCATGTACAGGGAGAGCTGCAAGGGGAAAC
TCAGCAAGTGGCTCCCATTCCGCCTCAGCTCTATTGTAGCCTCCCTCGTCCTCCTGCACG
TCTTTGACTCCTTGAAACCCCCATCCCAAGTCGAGCTGGTCTTCTACGTCTTGTCCTTCT
GCAAGAGTGCGGTAGTGCCCCTGGCATCCGTCAGTGTCATCCCCTACTGCCTCGCCCAGG
TCCTGGGCCAGCCGCACAAGAAGTCGTTGTAAGAGATGTGGAGTCTTCGGTGTTTAAAGT
CAACAACCATGCCAGGGATTGAGGAGGACTACTATTTGAAGCAATGGGCACTGGTATTTG
GAGCAAGTGACATGCCATCCATTCTGCCGTCGTGGAATTAAATCACGGATGGCAGATTGG
AGGGTCGCCTGGCTTATTCCCATGTGTGACTCCAGCCTGCCCTCAGCACAGACTCTTTCA
GATGGAGGTGCCATATCACGTACACCATATGCAAGTTTCCCGCCAGGAGGTCCTCCTCTC
TCTACTTGAATACTCTCACAAGTAGGGAGCTCACTCCCACTGGAACAGCCCATTTTATCT
TTGAATGGTCTTCTGCCAGCCCATTTTGAGGCCAGAGGTGCTGTCAGCTCAGGTGGTCCT
CTTTTACAATCCTAATCATATTGGGTAATGTTTTTGAAAAGCTAATGAAGCTATTGAGAA
AGACCTGTTGCTAGAAGTTGGGTTGTTCTGGATTTTCCCCTGAAGACTTACTTATTCTTC
CGTCACATATACAAAAGCAAGACTTCCAGGTAGGGCCAGCTCACAAGCCCAGGCTGGAGA
TCCTAACTGAGAATTTTCTACCTGTGTTCATTCTTACCGAGAAAAGGAGAAAGGAGCTCT
GAATCTGATAGGAAAAGAAGGCTGCCTAAGGAGGAGTTTTTAGTATGTGGCGTATCATGC
AAGTGCTATGCCAAGCCATGTCTAAATGGCTTTAATTATATAGTAATGCACTCTCAGTAA
TGGGGGACCAGCTTAAGTATAATTAATAGATGGTTAGTGGGGTAATTCTGCTTCTAGTAT
TTTTTTTACTGTGCATACATGTTCATCGTATTTCCTTGGATTTCTGAATGGCTGCAGTGA
CCCAGATATTGCACTAGGTCAAAACATTCAGGTATAGCTGACATCTCCTCTATCACATTA
CATCATCCTCCTTATAAGCCCAGCTCTGCTTTTTCCAGATTCTTCCACTGGCTCCACATC
CACCCCACTGGATCTTCAGAAGGCTAGAGGGCGACTCTGGTGGTGCTTTTGTATGTTTCA
ATTAGGCTCTGAAATCTTGGGCAAAATGACAAGGGGAGGGCCAGGATTCCTCTCTCAGGT
CACTCCAGTGTTACTTTTAATTCCTAGAGGGTAAATATGACTCCTTTCTCTATCCCAAGC
CAACCAAGAGCACATTCTTAAAGGAAAAGTCAACATCTTCTCTCTTTTTTTTTTTTTTTG
AGACAGGGTCTCACTATGTTGCCCAGGCTGCTCTTGAATTCCTGGGCTCAAGCAGTCCTC
CCACCCTACCACAGCGTCCCGCGTAGCTGGGACTACAGGTGCAAGCCACTATGTCCAGCT
AGCCAACTCCTCCTTGCCTGCTTTTCTTTTTTTTTCTTTTTTTGAGACGGCGCACCTATC
ACCCAGGCTGGAGTGGAGTGGCACGATCTTGGCTCACTGCAACCTCTTCCTCCTGGTTCA
AGCGATTCTCATGTCTCAGCCTCCTCAGTAGCTAGGACTACCGGCGTGCACCACCATGCC
AGGCTAATTTTTATATTTTTAGAATTTTAGAAGAGATGGGATTTCATCATGTTGGCCAGG
CTGGTCTCGAACTCCTGACCTCAAGTGATCCACCTGCCTTGGCCTCCCAAGGTGCTAGGA
TTACAGGCATGAGCCACCGCACCGGGCCCTCCTTGCCTGTTTTTCAATCTCATCTGATAT
GCAGAGTATTTCTGCCCCACCCACCTACCCCCCAAAAAAAGCTGAAGCCTATTTATTTGA
AAGTCCTTGTTTTTGCTACTAATTATATAGTATACCATACATTATCATTCAAAACAACCA
TCCTGCTCATAACATCTTTGAAAAGAAAAATATATATGTGCAGTATTTTATTAAAGCAAC
ATTTTATTTAAGAATAAAGTCTTGTTAATTACTATATTTTAGATGCAATGTGATC
tgaagtttctaattctggcccaactaaatttctagctctgtttccctaaacaaataattt
ggtttctctgtgcctgcattttccctttggagaagaaaagtgctctctcttgagttgacc
gagagtcccattagggatagggagacttaaatgcatccacaggggcacaggcagagttga