Gene CHAD Variant 1
DNA : 4.46 KbNT_010783
mRNA : 1783 bp NM_001267
CDS : 1080 bp NP_001258
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  923 bp
ggtaggcagaggagcaccataggagagcggggggctacagccggggctcagggctcgggg
ctcgggggccacggtcccaccccctcatgcacggtagccggctgggggaacggccccgcc
cccttccccgtggagggcgggggcgcatctctgggcgcgagcgagttaagcccagtggcc
TCGATGCTCCACGTAGGAGCTGGCTCGGCTGCCGGCTGCGGTCAGGGCCACCGTATAAAG
AGGGCGGCAGACCCGAGCGCCTAGGACTCGCCGCTGCCCGCGCCCCGCCGCCGCTGCTGC
CCCCAGCCCCGGCCCCAGGCGTCCCAGCCATGGTCCGCCCAATGCTCTTGCTCAGCCTCG
GCCTCCTGGCTGGTCTGCTGCCGGCGCTGGCCGCCTGCCCCCAGAACTGCCACTGCCACA
GCGACCTGCAGCACGTCATCTGCGACAAGGTGGGGCTGCAGAAGATCCCCAAGGTGTCAG
AGAAGACCAAGCTGCTCAACCTACAGCGCAACAACTTCCCGGTGCTGGCTGCCAATTCGT
TCCGGGCCATGCCGAACCTCGTGTCATTGCACCTGCAGCACTGCCAGATCCGCGAGGTGG
CCGCCGGTGCCTTCCGCGGCCTCAAGCAACTTATCTACTTGTACCTGTCCCATAACGACA
TCCGCGTGCTGCGCGCAGGTGCCTTCGACGACCTGACCGAGCTGACCTACCTCTACCTGG
ACCACAACAAGGTCACTGAGCTGCCCCGGGGGTTGCTCTCCCCGCTGGTCAACCTCTTCA
TCTTGCAGCTCAACAACAACAAGATCCGTGAGCTGCGCGCAGGCGCCTTCCAGGGAGCCA
AGGACCTGCGCTGGCTCTACCTGTCGGAAAACGCGTTGAGCTCCCTGCAGCCCGGGGCCC
TGGACGACGTGGAGAACCTCGCCAAATTCCACGTGGACAGGAACCAGCTGTCCAGCTACC
CCTCAGCTGCCCTGAGCAAGCTACGGGTGGTGGAGGAGCTGAAGCTGTCCCACAACCCCC
TGAAAAGCATCCCGGACAATGCCTTCCAGTCCTTTGGCAGATACCTGGAGACCCTCTGGC
TGGACAACACCAACCTGGAGAAG
gtgagctcctggctgtgggctctgccctggttccttcttcccttcctggaggccccagga
gccagggccacagctggcaccatcccccgtccccaggttccctgtccctctggctatctc
caaggtgagcagctctgccacctcccttcctcgccttgtcacatccctaccctaatccct
EXON 2  164 bp
agggggttgtgtagattggattatctgagatcacttggtcatactgctttgaaaactggg
aaactcctcaaagtgctatggctcaggttcagggaaggatcctgcccctctggcactcgg
gtgcttactcattcactcatgaccaccttgctcccaccttgctcccaccttgctccccag
TTCTCAGATGGTGCCTTCCTGGGTGTAACCACGCTGAAACACGTCCATTTGGAGAACAAC
CGCTTGAACCAGCTACCCTCCAACTTCCCCTTCGACAGCCTGGAGACCCTCGCCCTTACC
AATAACCCCTGGAAGTGTACCTGCCAGCTCCGGGGCCTTCGGCG
gtaagaacacttccatgtcactcccagagcccaccctcatgtgatagaggcacattagcc
ctgcactaagacatgttggacatgcatcctagatctgctacctaataagcatgggaccct
gggagcctcagtttccccatttgtaaaatgaagatgacagcttcagactatcctgtggcc
EXON 3  146 bp
cctagatctgctacctaataagcatgggaccctgggagcctcagtttccccatttgtaaa
atgaagatgacagcttcagactatcctgtggccaagtcaatcctggccccatagttcact
gcccttccccccagcactcccaccttcttccccagccccagcaagtttctgtctctccag
GTGGCTGGAAGCCAAGGCCTCCCGCCCAGATGCCACCTGTGCCTCACCTGCCAAGTTCAA
GGGCCAGCACATCCGTGACACGGACGCCTTCCGCAGCTGCAAGTTCCCCACCAAGAGGTC
CAAGAAAGCTGGCCGCCATTAAACAG
gtgggggccaggtaaacaggtcccctatgtccctctttggtgattccagcaagtgagctg
gtatcttccaggataccccctggccctggagggtcaggcagaccctccatttttacagag
agaggaggggacgactgggtcccctgttgaagggaggaaaaggtcctgcccaggacttcc
EXON 4  550 bp
cttccaggataccccctggccctggagggtcaggcagaccctccatttttacagagagag
gaggggacgactgggtcccctgttgaagggaggaaaaggtcctgcccaggacttccacca
ttttcttcaagcatcatctgtgttgttggagtactgacatcgatctttgcctctttgcag
GTTCTGACCCAGCCAGTCCTGGTGACTGGCCTCTGCCTTCCACCGGAGAGACTACTGACC
TTCTCACCTCCACCCATACCTTCTCCCCACAGCCTCTGCTGATGCACAGAGCTGCCTACA
CCTAGACACGTCCTGGCAGGGGGCCTCGGGCACTCCACTACCAACCCAGCTCCACCCAGC
AGTGTCCTGGGGAGAAGGAAGGCTGAGCCTCTCCCCAGCCTTCATGCCTTCCCCACCCTC
CAGCTCCTCTTGGAGAAGCTGTTGCTGAGACCCCCCCCCCAAGTCAATCAGAACCACAAC
AGGTTGGTCATCAGGATGGCCACCCTCCCAGGATCATCCTTCCTCTGTTCCTCTTTCCCT
GCCACGTGGAAACAATCATCAGATCCTTGCCCCACCCCTTGCTTCCAGAAAGGGTTTTAA
AGCCCATGCCCCAACTCTGCCAGCCCCCACCTGCCAGGACGTTCTAGCAGGACATCGGTG
CTTTGCTGTCCATCTTCCCATGCTGCAATTTCTTCCTGAGATTTCTATAAATATAAATGT
ATGTATGTAT
tatatttactcccctgccacctatctccttcacccaccaggtgctgatgaggtcagacta
tcttttctcacatctgctttctggaaggagggctggctgagagggtctcctttgaacatc
tggcctggactcatccccatgtctgtccatctgctgtcatcccaggcctggcctgcccac