Gene BIRC5 Variant 1
DNA : 10.43 KbNT_010641
mRNA : 1620 bp NM_001168
CDS : 429 bp NP_001159
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  160 bp
gcagggacgagctggcgcggcgtcgctgggtgcaccgcgaccacgggcagagccacgcgg
cgggaggactacaactcccggcacaccccgcgccgccccgcctctactcccagaaggccg
cggggggtggaccgcctaagagggcgtgcgctcccgacatgccccgcggcgcgccattaa
CCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCC
GACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAA
CTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGG
gtgagactgcccggcctcctggggtcccccacgcccgccttgccctgtccctagcgaggc
cactgtgactgggcctcgggggtacaagccgccctcccctccccgtcctgtccccagcga
ggccactgtggctgggccccttgggtccaggccggcctcccctccctgctttgtccccat
EXON 2  110 bp
gcctcgggggtacaagccgccctcccctccccgtcctgtccccagcgaggccactgtggc
tgggccccttgggtccaggccggcctcccctccctgctttgtccccatcgaggcctttgt
ggctgggcctcggggttccgggctgccacgtccactcacgagctgtgctgtcccttgcag
ATGGCCGAGGCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGT
TTCTTCTGCTTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCAT
gtaagtcttctctggccagcctcgatgggctttgttttgaactgagttgtcaaaagattt
gagttgcaaagacacttagtatgggagggttgctttccaccctcattgcttcttaaacag
ctgttgtgaacggatacctctctatatgctggtgccttggtgatgcttacaacctaatta
EXON 3  118 bp
ggtgccatatgggaatgtggcttgggcaaagcactgatgccatcaacttcagacttgacg
tcttactcctgaggcagagcagggtgtgcctgtggagggcgtggggaggtggcccgtggg
gagtggactgccgctttaatcccttcagctgcctttccgctgttgttttgatttttctag
AGAGGAACATAAAAAGCATTCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGA
AGAATTAACCCTTGGTGAATTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATT
gtatgtattgggaataagaactgctcaaaccctgttcaatgtctttagcactaaactacc
tagtccctcaaagggactctgtgttttcctcaggaagcattttttttttttttctgagat
agagtttcactcttgttgcccaggctggagtgcaatggtgcaatcttggctcactgcaac
EXON 4  1232 bp
gggagttgagctgaatcaggatgtttgtcccaggtagctgggaatctgcctagcccagtg
cccagtttatttaggtgctctctcagtgttccctgattgttttttcctttgtcatcttat
ctacaggatgtgactgggaagctctggtttcagtgtcatgtgtctattctttatttccag
GCAAAGGAAACCAACAATAAGAAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGT
GCCATCGAGCAGCTGGCTGCCATGGATTGAGGCCTCTGGCCGGAGCTGCCTGGTCCCAGA
GTGGCTGCACCACTTCCAGGGTTTATTCCCTGGTGCCACCAGCCTTCCTGTGGGCCCCTT
AGCAATGTCTTAGGAAAGGAGATCAACATTTTCAAATTAGATGTTTCAACTGTGCTCTTG
TTTTGTCTTGAAAGTGGCACCAGAGGTGCTTCTGCCTGTGCAGCGGGTGCTGCTGGTAAC
AGTGGCTGCTTCTCTCTCTCTCTCTCTTTTTTGGGGGCTCATTTTTGCTGTTTTGATTCC
CGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCAGTGTCCCTTTTGCTAGAGCTGA
CAGCTTTGTTCGCGTGGGCAGAGCCTTCCACAGTGAATGTGTCTGGACCTCATGTTGTTG
AGGCTGTCACAGTCCTGAGTGTGGACTTGGCAGGTGCCTGTTGAATCTGAGCTGCAGGTT
CCTTATCTGTCACACCTGTGCCTCCTCAGAGGACAGTTTTTTTGTTGTTGTGTTTTTTTG
TTTTTTTTTTTTTGGTAGATGCATGACTTGTGTGTGATGAGAGAATGGAGACAGAGTCCC
TGGCTCCTCTACTGTTTAACAACATGGCTTTCTTATTTTGTTTGAATTGTTAATTCACAG
AATAGCACAAACTACAATTAAAACTAAGCACAAAGCCATTCTAAGTCATTGGGGAAACGG
GGTGAACTTCAGGTGGATGAGGAGACAGAATAGAGTGATAGGAAGCGTCTGGCAGATACT
CCTTTTGCCACTGCTGTGTGATTAGACAGGCCCAGTGAGCCGCGGGGCACATGCTGGCCG
CTCCTCCCTCAGAAAAAGGCAGTGGCCTAAATCCTTTTTAAATGACTTGGCTCGATGCTG
TGGGGGACTGGCTGGGCTGCTGCAGGCCGTGTGTCTGTCAGCCCAACCTTCACATCTGTC
ACGTTCTCCACACGGGGGAGAGACGCAGTCCGCCCAGGTCCCCGCTTTCTTTGGAGGCAG
CAGCTCCCGCAGGGCTGAAGTCTGGCGTAAGATGATGGATTTGATTCGCCCTCCTCCCTG
TCATAGAGCTGCAGGGTGGATTGTTACAGCTTCGCTGGAAACCTCTGGAGGTCATCTCGG
CTGTTCCTGAGAAATAAAAAGCCTGTCATTTC
aaacactgctgtggaccctactgggtttttaaaatattgtcagtttttcatcgtcgtccc
tagcctgccaacagccatctgcccagacagccgcagtgaggatgagcgtcctggcagaga
cgcagttgtctctgggcgcttgccagagccacgaaccccagacctgtttgtatcatccgg