Gene BCL6B Variant 1
DNA : 4.98 KbNT_010718
mRNA : 1912 bp NM_181844
CDS : 1440 bp NP_862827
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  28 bp
ttgtttctgaggtcccgccctcgagacggagaccccgccctggactcgccatctggagag
cgagggaggaaggaaggatacagacccaggcgttcaccccacctccacccccgcccccga
catcccggccagataaaggagccgaggccaagaggggagagagaccccgccccccttaag
AAGAGAAGCCGCGGCCCCTGCAGGACGG
gggtaagaacaagagactgagggagccagactcctgggtcccccaagagggtaggagctt
gtgtggagcttgccatcagcgagcctgagtcccagaaattgggctaaactagggattggg
gactagataggagtcgcagaattccgtagttcggggaagggagcctcggctgggatttgg
EXON 2  191 bp
gggagcgagggtgtcgtagagggcagaatgaacaagaagaattaggagggaggctgcgtg
tgccggggctaggggctggaagtcctggctctagttgcacctcggaaggaaaaggcaaac
agaggagggaaggcgtcttaggactgcctggatccagagcactttccacggcctctacag
GCCTGTGTCGCTATGGGTTCCCCCGCCGCCCCGGAGGGAGCGCTGGGCTACGTCCGCGAG
TTCACTCGCCACTCCTCCGACGTGCTGGGCAACCTCAACGAGCTGCGCCTGCGCGGGATC
CTCACTGACGTCACGCTGCTGGTTGGCGGGCAACCCCTCAGAGCACACAAGGCAGTTCTC
ATCGCCTGCAG
gttcgaggggtggggcctggggcggggccaaatgggaaaggggtgggaccacagggccgt
tgagagggaatccgaagccaagtctttcagaagcaggaggcggagcgtcccagaattggg
ggcggggtgatagtgaggaggcgggactttttcagggggcggggcttcctgaagctgcgc
EXON 3  222 bp
agggccgttgagagggaatccgaagccaagtctttcagaagcaggaggcggagcgtccca
gaattgggggcggggtgatagtgaggaggcgggactttttcagggggcggggcttcctga
agctgcgcatgtctcccttggttccccagcccccaaaggacttatctgctctctctctag
TGGCTTCTTCTATTCAATTTTCCGGGGCCGTGCGGGAGTCGGGGTGGACGTGCTCTCTCT
GCCCGGGGGTCCCGAAGCGAGAGGCTTCGCCCCTCTATTGGACTTCATGTACACTTCGCG
CCTGCGCCTCTCTCCAGCCACTGCACCAGCAGTCCTAGCGGCCGCCACCTATTTGCAGAT
GGAGCACGTGGTCCAGGCATGCCACCGCTTCATCCAGGCCAG
gtgagggaccctggctcggcgttctctgtgggtgaggtgttaagggcaaaggcagagttt
aggaaatggcactaacgttcatcacactttccccagctatgaacctctgggcatctccct
gcgccccctggaagcagaacccccaacacccccaacggcccctccaccaggtagtcccag
EXON 4  363 bp
cactgcaccagcagtcctagcggccgccacctatttgcagatggagcacgtggtccaggc
atgccaccgcttcatccaggccaggtgagggaccctggctcggcgttctctgtgggtgag
gtgttaagggcaaaggcagagtttaggaaatggcactaacgttcatcacactttccccag
CTATGAACCTCTGGGCATCTCCCTGCGCCCCCTGGAAGCAGAACCCCCAACACCCCCAAC
GGCCCCTCCACCAGGTAGTCCCAGGCGCTCCGAAGGACACCCAGACCCACCTACTGAATC
TCGAAGCTGCAGTCAAGGCCCCCCCAGTCCAGCCAGCCCTGACCCCAAGGCCTGCAACTG
GAAAAAGTACAAGTACATCGTGCTAAACTCTCAGGCCTCCCAAGCAGGGAGCCTGGTCGG
GGAGAGAAGTTCTGGTCAACCTTGCCCCCAAGCCAGGCTCCCCAGTGGAGACGAGGCCTC
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGTGAAGAAGGACCCATTCCTGGTCCCCAGAG
CAG
gtacagagtctagaacctcaagaatttgtcagagctggcctcagctagaagacagagtca
ttgggccttgatggtcaggaggaagggagataggtggtgggtttcagagacactagctca
ccttaaggagctggccagagaccaggtttattcagcagggtggcacttgggcagtacaat
EXON 5  125 bp
ggccagagaccaggtttattcagcagggtggcacttgggcagtacaatggatgtggctca
ttggtcaacaatattggctcaccctgagagggcaggcctttggctccaaatttcccagga
gagaacccccacccctcaaccgtacaatctcttttaaccctttccttgccatctgcctag
GCTCTCTCCAACTGCTGCCACTGTGCAGTTCAAATGTGGGGCTCCAGCCAGTACCCCCTA
CCTCCTCACATCCCAGGCTCAAGACACCTCTGGATCACCCTCTGAACGGGCTCGTCCACT
ACCGG
gtaagagcccctctttcttggcttttctcccgtgactgctccaggcaagtttgtgccaaa
aactctcccagaaaggcctattccaatggttcctaaactttattacaaattagaatcacc
taggaagcttttaaactcccactgcccaggtcacactccatagattaaaatatctggaca
EXON 6  165 bp
gtcagatctggctcatcttactatcttcttacttggccttgagcaagtcaaaccagcccc
agaagtcttaacaataaattgggaaacagaaagcctgctactgtgtggtttgaggattca
gtagtacctagatagccctcattaataactatggttgccgtcacccattccccttcccag
GAAGTGAATTTTTCAGCTGCCAGAACTGTGAGGCTGTGGCAGGGTGCTCATCGGGGCTGG
ACTCCTTGGTTCCTGGGGACGAAGACAAACCCTATAAGTGTCAGCTGTGCCGGTCTTCGT
TCCGCTACAAGGGCAACCTTGCCAGTCATCGTACAGTGCACACAG
gtaggggaagagagggccctggccttcaagcccacagctgtcctagggcaaagtccctga
tctcccatgttctctgcctccaggggaaaagccttaccactgctcaatctgcggagcccg
ttttaaccggccagcaaacctgaaaacgcacagccgcatccattcgggagagaagccgta
EXON 7  131 bp
gttcctggggacgaagacaaaccctataagtgtcagctgtgccggtcttcgttccgctac
aagggcaaccttgccagtcatcgtacagtgcacacaggtaggggaagagagggccctggc
cttcaagcccacagctgtcctagggcaaagtccctgatctcccatgttctctgcctccag
GGGAAAAGCCTTACCACTGCTCAATCTGCGGAGCCCGTTTTAACCGGCCAGCAAACCTGA
AAACGCACAGCCGCATCCATTCGGGAGAGAAGCCGTATAAGTGTGAGACGTGCGGCTCGC
GCTTTGTACAG
gtacggagccagcctccaagtggcttccaaggcaaacctgcaagaggtggggtgggccaa
tagggagggttctgttcctcccagaggcaggacttgaagtctcctccctcccaggtggca
catctgcgggcgcacgtgctgatccacaccggggagaagccctacccttgccctacctgc
EXON 8  138 bp
cacagccgcatccattcgggagagaagccgtataagtgtgagacgtgcggctcgcgcttt
gtacaggtacggagccagcctccaagtggcttccaaggcaaacctgcaagaggtggggtg
ggccaatagggagggttctgttcctcccagaggcaggacttgaagtctcctccctcccag
GTGGCACATCTGCGGGCGCACGTGCTGATCCACACCGGGGAGAAGCCCTACCCTTGCCCT
ACCTGCGGAACCCGCTTCCGCCACCTGCAGACCCTCAAGAGCCACGTTCGCATCCACACC
GGAGAGAAGCCTTACCAC
gtgggtacccaacctggcctgcccactgccttagaattacctctcctttgcctaggggtg
ggctctgagaggtgcgggcctggctgtccctagatctcttagaaatgagcggtggccgga
agagtccaagcaaataaggggtggaggctgggagtcaggatgggcaggtatagaagtgat
EXON 9  549 bp
tgctaaataaggcggggcctatcccctcagccacccctgaggatttgggaggatgtgaga
gtcaaagagctgatcttccgctggatagttcccacctgggagagctggacggccgcccgg
ctcaacacctaaaaggtgattgtggatggggcagggcctgacttggctgtcctcccacag
TGCGACCCCTGTGGCCTGCATTTCCGGCACAAGAGTCAACTGCGGCTGCATCTGCGCCAG
AAACACGGAGCTGCTACCAACACCAAAGTGCACTACCACATTCTCGGGGGGCCCTAGCTG
AGCGCAGGCCCAGGCCCCACTTGCTTCCTGCGGGTGGGAAAGCTGCAGGCCCAGGCCTTG
CTTCCCTATCAGGCTTGGGCATAGGGGTGTGCCAGGCCACTTTGGTATCAGAAATTGCCA
CCCTCTTAATTTCTCACTGGGGAGAGCAGGGGTGGCAGATCCTGGCTAGATCTGCCTCTG
TTTTGCTGGTCAAAACCTCTTCCCCACAAGCCAGATTGTTTCTGAGGAGAGAGCTAGCTA
GGGGCTGGGAAAGGGGAGAGATTGGAGTCCTGGTCTCCCTAAGGGAATAGCCCTCCACCT
GTGGCCCCCATTGCATTCAGTTTATCTGTAAATATAATTTATTGAGGCCTTTGGGTGGCA
CCGGGGCCTTCATTCGATTGCATTTCCCACTCCCCTCTTCCACAAGTGTGATTAAAAGTG
ACCAGAAAC
acagaaggtgagatcacagctctgctggcagagattactagcccttggctctctcgtttg
gcttgggtattttatattatttctgtcataacttttatctttagaattgttctttctcct
gtttgtttgcttgttagtttgtttaaaatggaaaaaggggttctctgtgttctgcccctg