Gene BCAS3 Variant 1
DNA : 714.96 KbNT_010783
mRNA : 3495 bp NM_017679
CDS : 2742 bp NP_060149
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  43 bp
ggattggacacattcagaaggcgggtccgcctctttcctacttgctggttggcgaagctg
acctccaagggcggtgcccggccatagccggtttgcttctgggattggctagagggggtg
gttccgctgaggcgtggtaggaagtggctgccgtcaatcactcggggagactccaaacag
TGAGCCTAGAGCTGGAGACTAGCGTTAACCGGCGGGGCGGCCG
gtgagagggctggcagggctttggctttggggaggcttggggaggacgagggactggcgg
cgtgaggggactgggtcgggctggcaggaattcgacaggagagaggtgtcgatactggag
ggggaggggaacagtgcaaggggccggagggcggccgggggcagcggtggctccgtgttg
EXON 2  88 bp
taaaaacctacttcctccttttttccctttctggtgtaacaggaatttctgggaaagttt
cctacatttgaggcatttttgacaagggatctctagtgagtaatcataaatcttcctccc
tacccccaacaacgatccatgtttttctgttttttgtttgtttgtttgttctggaaacag
GTTTTATGAATGAAGCTATGGCTACAGATTCCCCAAGAAGACCCAGTCGTTGTACTGGTG
GAGTTGTGGTTCGCCCCCAGGCTGTCAC
gtaagcacatttcagataaacccaatagctgaagaaaagattactcagaatactaacatt
taggttttctttatgaacagtggttacttttgtaaaaatcttttaactgttggctttatg
ggatgaataataataattgccaagaccaaatgaagaattggagagttaagttgacgtatt
EXON 3  55 bp
agcctgggtgacagagtgaaaccttgtctcaaaacaaaacaaaacaaaacaaacaaaaaa
accccaaaaaacaaacaacaacaaaaaacaagtgactttattaaggcttgtaaatagagc
ttttttcatgttctatattaagctctcctgaccagtgttgtccatttcacccttttccag
AGAGCAGTCCTACATGGAAAGTGTTGTGACTTTTCTGCAGGATGTTGTGCCACAG
gtaagtgtctatatgtgctttcgcctttccctttggtcaggagagctctgaaatgtttgg
tttcctaaacttgacactagtaccagcaacttccaaaaggtttttgatgttttagcatcc
tgagcattcgtagggtgggactacattattgtttagatgtgccgcagtgttgtgatgaca
EXON 4  76 bp
atgagactcatggataatattctttgggggtaataatgttctaaaatattctagttacca
agatgtagggttggtgaagttggagaggtatagtgttggctttaagtcactttgttttga
acatcagtaatattaaagctgtaaaatatgtttattcaaatgtttctgtttactatgcag
GCTTACAGTGGAACACCTCTAACAGAAGAAAAGGAGAAAATAGTCTGGGTCAGATTTGAA
AATGCAGATTTAAATG
gtatggttttaactttttttgggacgtgtgaattaattgtttgtttggagtacctgattc
caaaaagagagcctctactttagtcagattactttctcttatagtaatttttcagttttc
aaaataaaaggtagcataaccgcagtacagaaactttagaactaatattgtgtaataagc
EXON 5  107 bp
gatatataaggaaatagatagccaggatggacaactttgagaattctggctatgaagaga
agagaggatggttgctagacaggtgtaaagattgaatcaggcattaaagaaatacagttg
ttttcttgattgccattatgtcttttaaatttgcttctttgttacttaattctaatgcag
ATACATCAAGAAATCTGGAATTTCATGAAATACATAGTACTGGGAATGAACCGCCTTTGT
TGATTATGATTGGCTACAGTGATGGAATGCAGGTCTGGAGCATCCCT
gtaagtacacatgtggttgaatacctaaaacatacttcccagcatgttagcttatgtgaa
atctgtagatactttttttttttgagacagagtctcactcttcgcccaggctggaatgca
gtggtgcgatctcggctcactgcaacctctgcctcccagcttcaagcgattctcctgcct
EXON 6  82 bp
ttgcagtaatttaagatatgaatatacttaacatgtatgaccaatgataaatgggtgtgg
gtgtatgtatatatatttcagacaaaatattgttataaaatttagaagatcttgttttta
tataatactgttgtgaccttcattttcccactgaaatattttctttcttctcttatgcag
ATCAGTGGTGAAGCACAAGAGCTCTTCTCTGTTCGACATGGCCCAATTCGAGCGGCTAGA
ATCTTGCCTGCTCCACAGTTTG
gtgagtgtagtccttaagaaaagaatctttcagaaaagagtttctcttttgttggtcttg
gactacaggcagcaagaatgataactaaagtctgttttcctccaagtgtccattcccctt
ccccacctcccccaaagataaacttagttctgtcagttgagatggaaataggtaatctta
EXON 7  73 bp
catatatataatatatgatgattttatatagtagcttttcttctttttattcaattgtat
aaattatgtcaacttataatgaatacttctccttttcaagtattttgaaagcatgaaaat
agtgggaattatacaataatattcctcaaagcttacaatttattttatccttcctgtcag
GTGCTCAAAAATGTGATAACTTTGCTGAAAAAAGACCCCTCCTTGGTGTTTGTAAGAGCA
TTGGATCTTCTGG
gtaaggaaattttaaaaattctttgtatcacctattacaaatttatattattccagaggg
agaactttgatgttataaaacctttgtaaccataagactaagctctcataagagagaaga
agaagaaagtaaaacatatttagggtttccaacagtaaatgacatttattgatgctatag
EXON 8  108 bp
tcctaacttgttgacttaaaataagggatgtattatgatcatttttgggataagttttga
atcaatttactaatatcttgttaatcagaggtttgaatattatgttaatgagaaagtata
gagattattggtctttcttttttaaaaaaatgacatttttctttcttttttcttttttag
CACAAGCCCACCGTACTGTTGTGTGGATCTGTATTCACTTCGTACTGGGGAGATGGTCAA
GTCCATTCAATTTAAGACACCTATTTATGATCTCCATTGCAATAAACG
gtaaggattttttcatgggtttcttgtgtaaaataagaaacatgctctcctgggcatgga
gaactctaccagtttcaatgactaacttagatttatttttaaaaatctcaaggaaacacc
ttctgaattctgttcagtggaataactctaagatttcttgatgaatatattcagacttct
EXON 9  77 bp
tttttacacattttaagaggcagaagtttctagcctaaatattataggaaatgtttaatt
ttaaaattgtattagtaggcacttgttttcatctagatgatataatgcatttctgattcc
acttacagaatttcacattcactttttttctttctgttttttttctctctctaattttag
GATCCTTGTCGTAGTCTTGCAGGAGAAAATTGCTGCCTTTGATAGCTGTACTTTCACGAA
GAAATTCTTTGTTACAA
gtatgtaccaattttttttcccttcttatgcctttgggtttatactacttacttgacaca
atcagcaaactaactgtaattttctcaacagtacttaatgttttcaattttgatgatttt
cttgtgattctgtggctattctcattgagtaatattcttgtatgatatatattttcaact
EXON 10  77 bp
agagggggaaaaatgcaccttacttagctaacaaaataatgactagtgttacaggaattt
tatgtgagacttgaaaaaatataagcatttgatttttctgtttttctggcatcgatatat
gatgcaccaacagaaaagttattaagaaatttctcaatagtgccatttgaaatttttcag
GCTGCTATCCATGTCCAGGGCCAAACATGAATCCTATTGCTCTTGGGAGCCGCTGGCTTG
CTTATGCAGAAAACAAG
gtaagacgtggcctgtgtttggattatttgtaatggagcaagtgttgaaggattttccat
aaaaaatacctgtgctccatagttgattaccaataataaatgttttacttactagttcat
ttgctttggtttggttttaattgtgcaactaataattgaactcgtttaagaatttataaa
EXON 11  84 bp
ataaaaaggggtagaagtgtctcggcaaagcttttagctgtttgtctgaaatacactcat
gcaaacattcccacccatcaccatcactgttcacggaaaataagctctatcctgatagcc
tgtagagttaaacagattaatagaaatgacgttctgcttctctctctctctttttctcag
TTGATTCGATGTCATCAGTCCCGTGGTGGAGCCTGTGGAGACAACATTCAGTCTTATACT
GCCACAGTCATTAGTGCTGCTAAA
gtgagtacctccgaaatcttggagagttgtggttatgtgtagtaattgttcagatttctc
tcctgaattatattttctattgtaatgattgtagtgcttgtacttatccaattttaaaga
ttttaagtctgttaactagcttcaagactgttacctaattaataccacatttggaagaag
EXON 12  171 bp
atattctaattaaaattcaagatcattaaaagtcagactgaatgtctgtgacagtttact
gctataaaagattgtaagagaataaataacataatgattaggaaaattaataaaatgcgt
atttctatgtagaatccaaatactgatgtgaagtcatacattttacctttcattgtacag
ACATTGAAAAGTGGCCTGACAATGGTAGGGAAAGTGGTGACTCAGCTGACAGGCACACTG
CCTTCAGGTGTGACAGAAGATGATGTTGCCATCCACAGTAATTCACGGCGGAGTCCTTTG
GTCCCAGGCATCATCACAGTTATTGACACCGAAACCGTTGGAGAGGGCCAG
gtaagaagaacttttggtgcgtaccatgtgtgttacttgcaaagatggggctaagatcaa
gattagtcaaaatgtatttggcctaggagattatcaatttggaattttaggaattcagat
tatttcaaatgaggtttttctttaaaaatgattagtaacatgttagaacctgctgttttg
EXON 13  94 bp
catgttatatctcttcctcaattctaaagtggaattctctccttatattggcaagaataa
tctgctagagtggaaacatgttatttggtcagtggtttgtgatgtgccttcttataggct
tcaagctcggttatcagtgagaaaatatttacctccatttgtctttatttctttgtgaag
GTGCTTGTGAGTGAGGATTCTGACAGTGATGGCATTGTGGCCCACTTCCCTGCCCATGAG
AAGCCAGTGTGCTGCATGGCTTTTAATACAAGTG
gtaagttcgctctctgtcttttttttttttttttttgtagaccatttatataatgggttt
tccagccaaatatggaatatggaatctgacttttcttcatgtatcagtatatatcagaaa
agttattaagtcattatattgaataaaggaatttataataaaaatttagtacccctctaa
EXON 14  134 bp
tcattaagcttggtattcacatgaaaaagatattttatttttttcttttgtaaagtttct
tatagccttggtaatttttttcccattggtaatattttaaatattgtgaatagcttttta
gaatatttcatccacatacataatcatttttatttttaccctttgttttttgtcttccag
GAATGCTTCTAGTCACAACAGACACCCTTGGCCATGACTTTCATGTCTTCCAAATTCTGA
CTCATCCTTGGTCCTCATCACAATGTGCTGTCCACCATCTGTATACTCTTCACAGGGGAG
AAACTGAAGCCAAA
gtaagctgtataatttttcagaaggcgatttcttggtgtaatatgacatctactctagct
ggtcatttatattacattgcagcttaatgttgatgtttgtgagaaaatattgctgtctgt
gatagaatgggttagataaatagggaaaaattccgttttgacccagtaaatacataagca
EXON 15  265 bp
agttttgatcaacagtcattgtgaaatgcatctgtagagtaaatttttatttattacctg
atcttaggtacatttggtaatgaggcaatcatttatattcatatttggtgatgtgtgata
ctcttagaaaaatccaagtagtttgagacatttttgtatcttttcttatctcatttctag
GTACAGGACATCTGCTTCAGCCATGACTGTCGCTGGGTTGTGGTCAGTACTCTCCGGGGT
ACTTCCCACGTTTTCCCCATCAACCCTTATGGTGGCCAGCCTTGTGTTCGTACACATATG
TCACCACGAGTAGTGAATCGCATGAGCCGTTTCCAGAAAAGTGCTGGACTGGAAGAGATT
GAACAAGAACTGACGTCTAAGCAAGGAGGTCGCTGTAGCCCTGTTCCAGGTCTATCAAGC
AGCCCTTCTGGGTCACCCTTGCATG
gtaattttctctgtctccactgttatcttgaatcttccttccctttgtccttatttttac
agatctgggataaaactaaacttgttatagtctgttcatgtaaaaagaagatcttaggct
tatatgaaattcttaattattaaataatttaataaattggagccagtatagtaatggtga
EXON 16  151 bp
gctctccaagaatagtttggtttcttctcatccacataattgtaattctcttggcatcaa
ttctacctttgatgcctttcttaaatgattactggagtcagtgaaaaccctatcggagat
agagaacgggagatagagaaccttcctcagtgatgcttttctttatttttctctttgtag
GGAAACTGAACAGCCAAGACTCCTATAACAATTTTACCAACAACAACCCTGGCAACCCTC
GGCTCTCTCCTCTTCCCAGCTTGATGGTAGTGATGCCTCTTGCACAAATCAAGCAGCCAA
TGACATTGGGGACCATCACCAAACGAACCGG
gtaaggccttagacttgatgcttttttaacagctgttttatagggttgaatgaataaaaa
taaaacatactttttctttgtgtggtttttattatgttcttcatttccagctcaaataag
acttaatggcatcagattaagtacaaagcatagaacttgcacaagcatacttgcacacaa
EXON 17  125 bp
aaataattctacttttactccagaacatagtctcacatcaccatttattacttaaggcaa
aatgcatgttcatactggaggatttgaataggggtggaatttaaaggaaaaactgtcatt
acctaaaggagtatcatttcatcatgataattgttttttactcttattttattttttaag
CAAAGTTAAACCTCCTCCACAAATTTCACCCAGCAAATCGATGGGCGGAGAATTTTGTGT
GGCTGCTATCTTCGGAACATCCAGGTCATGGTTTGCAAATAATGCAGGTCTGAAAAGAGA
AAAAG
gtatgtatttttactgaaaaatgaatgctctatttgtaatttttgcttcttaaggaaaat
ttttagcagtttccctagaataatcttgtacccagtagtctggaaaccaatttttttaat
gtaattagcatgtcacttctcaactactcaagcctagtcaagaagaaaaactatcctctc
EXON 18  166 bp
cctgggcagcaagagcaaaactccatctccaaaaaaaagaaaaaaagaaaaaaattcctg
tcttttcattttctctgagcagcctcaggagcagactaataagatcattaacttgtaaaa
attattctgtgctccatttatgccatcataacacatcgggttctgtttctctgtttgtag
ATCAGTCCAAACAAGTTGTAGTTGAGTCCCTGTACATTATCAGTTGCTATGGCACCTTAG
TGGAACACATGATGGAGCCGCGACCCCTCAGCACTGCACCCAAGATTAGTGACGACACAC
CACTGGAAATGATGACATCGCCTCGAGCCAGCTGGACTCTGGTTAG
gtagtacctcttttctttttttctttttaacagcttcattaaggtatagaagattaaaag
cgtataatttgataagttttgacatgcatacagctacgaaatcatcaccacaattaacat
ggtaaacaaatacatcactctcaaatgtttcttggtgaccctttgtaatctctccttctt
EXON 19  101 bp
tctaagcagatggccttgtgtttcaggtttcatcacattcattttaatgattacaagttc
attttaatgatcacaaaagtagtgtgagtttaagtcactgttcataagtgatgacagtca
tggtgatttacatcccatctattaagcttaaatattaatattcttctcctgtttccttag
AACCCCTCAATGGAATGAATTGCAGCCACCGTTTAATGCAAACCACCCTCTGCTCCTCGC
TGCAGATGCAGTACAGTATTATCAGTTCCTGCTTGCTGGCC
gtaagtagttcagattttttttttcctttcgtatggtctattcagatttcatcttaaaat
gctagctttgaaagcaaacattaccactggtccataggccatgggccttaaagaatcagt
ttgaggcaaataagatatttaatatgaatataaactgtaagccttagtatacattatgtc
EXON 20  101 bp
agtatcttattcctaagaacttcattcttacttgttcaataattgtttgaattgcctttt
tgctttaaagtattatattttatcttataaattaccatagtatccaaaatggttgtgccc
acgtctgtttttccactgcatggaatgaagtggtttaaatctattttctttctcctatag
TGGTTCCCCCTGGAAGTCCTGGGCCCATTACTCGACATGGGTCTTACGACAGTTTAGCTT
CTGACCATAGTGGACAGGAAGATGAAGAATGGCTTTCCCAG
gtaaaactctgaaatattgagagtattaaagtaaaataaaacagaaatttactgttttta
ttcttttccttagaggtaaaaggggagaattggtaactctttattggattatcaagaatt
agttgtctttccatattacaaattactccacaaatattgctgcaggtgtacatatacata
EXON 21  197 bp
tttgaatgtctacatcagctgtgattatcatcaccttttaattatgggtgtcctatccct
ttgccactttaacatgggcttcttgaagaatgtgggtgttaagaggaagaatgggggatt
gtgaagtctctcaaatcaggatcacaaaccatttaaatcatcattgctactccattccag
GTTGAAATTGTAACACACACTGGACCCCATAGACGTCTGTGGATGGGTCCACAGTTCCAG
TTCAAAACCATCCATCCCTCAGGCCAAACCACAGTTATCTCATCCAGTTCATCTGTGTTG
CAGTCTCATGGTCCGAGTGACACGCCACAGCCTCTTTTGGATTTTGATACAGATGATCTT
GATCTCAACAGTCTCAG
gtaggaaatgagaattagggagtgatttgaacaaaaggattaatatgttcgtgtgaaatg
agcatcatatgtaatatttaggtttccccttttggcacagtatcatgttgcagactacat
gtactgttgcacgtaattccctgtcattacttgagatggtatatagggtctcgtgggatc
EXON 22  98 bp
ttgtagtgttttatccttgtgcagcaattagggactgcagctcccctgtttgtcttgttt
tagaatggatggttctttaatggattgtgctactccagcattcctgatttaaggtcattt
gtagcaagtgacagttttgatgccagtaacatatgtgaattaaattaaattgcattgcag
GATCCAGCCAGTCCGCTCTGACCCCGTCAGCATGCCAGGGTCATCCCGTCCAGTCTCTGA
TCGAAGGGGAGTTTCCACAGTGATTGATGCTGCCTCAG
gtagaaaaccacctctgaaatatttattgggcagtcctgtgcatttttaactaattttct
cgcacaatgtagaggatgacatttatttgctttcctctctgtttttttgttttgtggtgt
gtgtgcattttaatacagtactgtgcctatatttcttgctgaacaatgccatgcttttaa
EXON 23  168 bp
actctctcagcggcatgagctatttctcctgcgctacccagtctgttggcggcgtgcttc
catcctacaggaaggctacaatggaccctgggtatggagaggagcgggtgggaggtagac
aagaatggcctgctccctgaaggtgtggactcaacgtcagatgtcccgtgtgtgccacag
GTACCTTTGACAGGAGCGTGACCCTGCTGGAGGTGTGCGGGAGCTGGCCTGAGGGCTTCG
GGCTGCGGCACATGTCCTCCATGGAGCACACGGAGGAGGGCCTCCGGGAGCGACTTGCCG
ACGCCATGGCCGAGTCACCTAGCCGGGACGTCGTGGGATCCGGAACAG
gtaaaggtgtcatcagacttctagcctgatttggtcaggaccagcacctgttggtgcaga
gcttctctggaatcgtttgtgggcatatgtttgtttttgctgttggtttctttagttagc
actccagtggctatccgtctgaggagctctggtgttgggaaaccctgtgtaaaggggagc
EXON 24  854 bp
ctgagccttcctgtgacctgagctgccccctgcccatccagggagcaggcggggatcccc
ctgcggaaggacacaagtgaacccagaatggtgcctcaaggcaggcagcctggcccagat
ggtgcccccactccccagacccaactctaaccaggcctggccctctcctgtgtcttgcag
AACTTCAGCGAGAGGGAAGCATCGAGACTCTGAGTAACAGCTCAGGCTCCACCAGCGGCA
GCATACCAAGAAACTTTGATGGCTACCGATCTCCGCTGCCCACCAATGAGAGCCAGCCCC
TCAGCCTCTTCCCGACTGGCTTCCCGTAGGTACCAGCAACCTGCTTCTGACTGGCCAGCC
CCCTCCCCTGCTGGAGGAGGGGAGAAGCCCCGCTCTGGTCCTACCCTTCAGTCTCTGCTC
TTCCTTCATCAACCACCTTCCCCAAGCTTAGTGACAGCAGCCGCCCATCCTACCTGGATG
GAGAAGAGACCCTTCTCCAAGCACCTCAGCGCACTTGCCCTCTGCCACACCTGTCGGTGG
AGGCTGTGGCCAGGAGAGACTGTAGAAGCTCGGTCCCTGTGTATGTTTGCATATGACATC
CTGCATTGGATCCGCTTTTGTATTTTTTAACCATACCCACGGTGGGGCGGGTGGGGGGAG
CCTGGAACAGTGACCAGATCTGGGGGCCTGAGTGGGGACAGAGTTGATCGTCCACCTGGC
CATTTTGACCCTGAGTGGACAGTCACAGCCTCAGCTCATGTCTGGCTGTGACACACACTG
CCCCCAGCTTCCCTTGGTCAGCCCCACTCCAGCACGGGGTGAACGGAGGCCCAGAGTACT
AGGGAAGGAGGAAGGGAGGACATGCCTCTTCTTCCTCCTTTCTTTCCCCATCTGTTCATG
GGAAGAGTTTGTCTTTCTTATCTTTAAGCCCCTTTACCCTGGTCCTGTACTGATCAGTGA
AGGAAACCGTGGTTACTGAGGCCCTGTTGAAAAGTGCACGTCTTGTCCAATAAATCACGC
TGCAGTTGGTGTCC
atccctgagttgctggggtaagggtcctctccaaatgctgagcagagtcctatggcctga
gtgcccaggatcccaacaccccctttcatgtgcaacttgggggcagaaggagtcagtgga
ggattggaatgggaagaacttttgtcctggaatttggatggggcctgatttaagaagccc