Gene AXIN2 Variant 1
DNA : 29.18 KbNT_010783
mRNA : 3071 bp NM_004655
CDS : 2532 bp NP_004646
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  904 bp
atgagcacctcgcagatagctgggttgcttgatttgaatttgaggagttgaaaagcctgt
ttactttcttgctttgatgttgggtagatctggttttgattagatcaatacccttttctc
tctccccacctccccccttccttttctttccagagaggaggttcagatgagcccctgctg
ACTTGAGAGAGACAGAGAGACCACGCCGATTGCTGAGAGGAACTGGAAGAAGAAAAATTC
CCAGACTCAGTGGGAAGAGCTCCCTCACCATGAGTAGCGCTATGTTGGTGACTTGCCTCC
CGGACCCCAGCAGCAGCTTCCGTGAGGATGCCCCGCGGCCCCCAGTGCCAGGGGAAGAAG
GGGAGACCCCACCGTGTCAGCCAGGGGTGGGCAAGGGCCAGGTCACCAAACCCATGCCTG
TCTCTTCCAACACCAGGCGGAACGAAGATGGGTTGGGGGAGCCGGAGGGGCGGGCATCTC
CGGATTCCCCTCTGACCCGGTGGACCAAGTCCTTACACTCCTTATTGGGCGATCAAGACG
GTGCTTACCTGTTCCGAACTTTCCTGGAGAGGGAGAAATGCGTGGATACCTTAGACTTCT
GGTTTGCCTGCAATGGATTCAGGCAGATGAACCTGAAGGATACCAAAACTTTACGAGTAG
CCAAAGCGATCTACAAAAGGTACATTGAGAACAACAGCATTGTCTCCAAGCAGCTGAAGC
CTGCCACCAAGACCTACATAAGAGATGGCATCAAGAAGCAGCAGATTGATTCCATCATGT
TTGACCAGGCGCAGACCGAGATCCAGTCGGTGATGGAGGAAAATGCCTACCAGATGTTTT
TGACTTCTGATATATACCTCGAATATGTGAGGAGTGGGGGAGAAAACACAGCTTACATGA
GTAATGGGGGACTCGGGAGCCTAAAGGTCGTGTGTGGCTATCTCCCCACCTTGAATGAAG
AAGAGGAGTGGACTTGTGCCGACTTCAAGTGCAAACTTTCGCCAACCGTGGTTGGCTTGT
CCAGCAAAACTCTGAGGGCCACGGCGAGTGTGAGGTCCACGGAAACTGTTGACAGTGGAT
ACAG
gtaagactttgacgggggcgggtgggctgatgctgtggactttgcagatgttttaagtat
ggtggatgggtggatgggtgtgctgcagagactgacaggtctgttgagttaggactgctg
gccatgaaccctttttgatcttgctttttgttgttgaaacagggggaaagcgatgcacat
EXON 2  141 bp
ggctcaggaggcctcccttttgtggcccctgctttctgcccaggtgagcaactggacctg
ggcagcaggttggcgttgagcagattgtgggatagtgtgctgggttgtcctggggtcacc
tgattacctgggtttctggtgagggtcagtgactgaaccacttttgtactttgcccatag
GTCCTTCAAGAGGAGCGATCCTGTTAATCCTTATCACATAGGTTCTGGCTATGTCTTTGC
ACCAGCCACCAGCGCCAACGACAGTGAGATATCCAGTGATGCGCTGACGGATGATTCCAT
GTCCATGACGGACAGCAGTGT
gtgagtatcctggccacccttccgtgggcttgcttgggagtggatgccacctgagcactt
agccagaatcgtctgtcatcctcagctggctttgcagaccgcacctgtgcatgtatggac
atcagtttggtgggaggggagtatgacaagggtatggtgctgattaaggaggatgacatg
EXON 3  103 bp
tttgaccttgggtgggtccttccctgtgggagcaccgatggtatctggagacatgtgaca
ctcctatggaagcatgtggccctgtcggcgggatctcaagatggcatatgacagtagccc
atgtgatgtgctgaaaacatcctcgtaagcctgtggattctgtcttttcctttcccttag
AGATGGAATTCCTCCTTATCGTGTGGGCAGTAAGAAACAGCTCCAGAGAGAAATGCATCG
CAGTGTGAAGGCCAATGGCCAAGTGTCTCTACCTCATTTCCCG
gtgagtacagtctggagtgaggagacagctgttttctgccatgttgagtcctaaagaaaa
gaaatgggtggtggaatggggagaggtatagggaaggtagaaaagagcagtacctaaggt
cccctagggcaaagggagagaaaagaactggacaataggcattacatggttttttgggtt
EXON 4  141 bp
tccatgaggccatggcgctagcgcataaaagtcccgagcagcccaggccgccttgccatc
cactctacacccgaacatgggtttgcggtgcacagcgcctggtgcgggaagctccggcca
agccaccgcccacctagcctgctgaacgtgcctcctccctttcctttccacgtcctgtag
AGAACCCACCGCCTGCCCAAGGAGATGACCCCCGTGGAACCCGCCACCTTTGCAGCTGAG
CTGATCTCGAGGCTGGAAAAGCTGAAGCTGGAGTTGGAGAGCCGCCACAGCCTGGAGGAG
CGCCTGCAGCAGATCCGAGAG
gtaatgcggcctaggccttcttcctgcttccgtccacggcgtgagcgctcgtatgtgtat
gcgcatgtgcatggggtgcgttagggtgtgcgcatgtgcgtgggttgcatgcgcatgcgc
gtgggctgcgtgtgggtgtgtgcctgggcgtgggctgtgtgcgcatgtgcatgggttgcg
EXON 5  512 bp
gtgcatatgcgtgtggatatgtgcttgtgtaggcgggcctgtgcgtgtgcgcatgggcgt
ggctgtgggcgtgcacacgggtgtgcgtgctcctgcgtagggagccgaatgttgcaaccc
cagggcctctggcccttctgcttcctgggtcacttctccttctgacgtcttccctttcag
GATGAAGAGAGAGAGGGCTCCGAGCTCACACTCAATTCGCGGGAGGGGGCGCCCACGCAG
CACCCCCTCTCCCTACTGCCCTCCGGCAGCTACGAGGAAGACCCGCAGACGATACTGGAC
GATCACCTGTCCAGGGTCCTCAAGACCCCTGGCTGCCAGTCTCCAGGCGTAGGCCGCTAT
AGCCCCCGCTCCCGCTCCCCGGACCACCACCACCACCACCATTCGCAGTACCACTCCCTG
CTCCCGCCCGGTGGCAAGCTGCCTCCCGCGGCCGCCTCGCCGGGCGCCTGCCCCCTCCTC
GGGGGCAAAGGCTTTGTGACCAAGCAGACGACGAAGCATGTCCACCACCACTACATCCAC
CACCATGCCGTCCCCAAGACCAAGGAGGAGATCGAGGCGGAGGCCACGCAGCGGGTGCAC
TGCTTCTGCCCTGGGGGCAGCGAGTATTACTGCTACTCGAAATGCAAAAGCCACTCCAAG
GCTCCGGAAACCATGCCCAGCGAGCAGTTTGG
gtaagtgccgggcggaccgcagtgtcccgtgtggggcttgtctcccagccaggtccatgg
gcaggtgtgaggtgggagccgcattacaggcatttagtttctaagagggcggcagagtgc
acggccgggtgagggtgcggggagcaggtgcatgggtctttcgtgtcaccagccccccga
EXON 6  195 bp
gcattacaggcatttagtttctaagagggcggcagagtgcacggccgggtgagggtgcgg
ggagcaggtgcatgggtctttcgtgtcaccagccccccgacttgctgaattgtctgattc
taggagtcccggagatttaaccgggtctctgggttgggtgtggttcttggttccccacag
CGGCAGCAGAGGCAGTACCTTGCCCAAACGCAATGGGAAAGGCACGGAGCCGGGCCTGGC
CCTGCCCGCCAGGGAAGGAGGGGCCCCCGGCGGAGCTGGGGCCCTGCAGCTTCCCCGGGA
GGAAGGAGACAGGTCGCAGGATGTCTGGCAGTGGATGCTGGAGAGTGAGCGGCAGAGCAA
GCCCAAGCCCCATAG
gtaaacaccgcttgccgccgccgcggccgcgagggtcatgggcactcagtacggaggtat
tgtgggaatggctgtttttgcagtccgcggaatacaaatgtgactatttgctcctgccat
cttaatattaaacgttggactgagcagaccacaaaaatgtcatgttttggcactgacccc
EXON 7  234 bp
tggactgagcagaccacaaaaatgtcatgttttggcactgacccctgttcatgttatggt
agttttttttttaactctctctctgagcagaatagacaagtttctattgaagtcacattt
tccagttcttctaacccagtttctttccttctgttttctctctgctcattccttgtttag
TGCCCAAAGCACAAAAAAGGCCTACCCCTTGGAGTCTGCCCGCTCGTCTCCAGGCGAACG
AGCCAGCCGGCACCATCTGTGGGGGGGCAACAGCGGGCACCCCCGCACCACCCCCCGTGC
CCACCTGTTCACCCAGGACCCTGCGATGCCTCCCCTGACCCCACCCAACACGCTGGCTCA
GCTGGAGGAGGCCTGTCGCAGGCTAGCTGAGGTGTCGAAGCCCCCAAAGCAGCG
gtgagtggaagtgaagggtcctaggttgaggcagggattgggtttgggtggagacctggt
ctgtggctaatggggagggcctctctttctgcctgggtctcaaaccctcccatgagaaga
agaattacttatggatgagtaagctgctgctttccagcttctagaaattgttcccttcag
EXON 8  96 bp
caagacgtcttcctggcctcttcagccactgttaacccagggtcttggttgggtctccgt
aaggatggaagtcgggttcgtgtctcttcaggaggccaaatagtaattttctgtctgctt
ttcaattgctctggggacaacagtgtacctctaaatccctcgccctggctgtgtcctcag
GTGCTGTGTGGCCAGTCAGCAGAGGGACAGGAATCATTCGGCCACTGTTCAGACGGGAGC
CACACCCTTCTCCAATCCAAGCCTGGCTCCAGAAGA
gtgagtgtctttacctgacattactgagatctgccgagtgctttatgtttcagaatattc
gctatctggagtttcattttcatgaaactttttttggtttttaaaatcactttgatttta
gcgctagtgatgaggaacagtaaacgtagatgttgccatccatgtcctgccgacaaatgc
EXON 9  168 bp
ccccagagctgcctgactctgggatgtggggctctgccccagcccccactttgggtttac
aattgcagccctagtgtttggataccctgtcacttatgcacatgtgcgcacgtgtgtgtt
tgctttagatgtgtgtctgctttaaaatgctaaacttgttccattccatcttattttcag
TCACAAAGAGCCAAAGAAACTGGCAGGTGTCCACGCGCTCCAGGCCAGTGAGTTGGTTGT
CACTTACTTTTTCTGTGGGGAAGAAATTCCATACCGGAGGATGCTGAAGGCTCAGAGCTT
GACCCTGGGCCACTTTAAAGAGCAGCTCAGCAAAAAGGGAAATTATAG
gtaagagtcctgtggcttttttctgctctcagtttgtttgctcagaaccaagagccagag
cctggagcagctcccctggctgagcagacctaggtggggcagggtgggagggggctcagc
aggcgctgggggaggctcccttctcatttcttctctcccctcaccgctagcagcaataac
EXON 10  577 bp
gcttcttgtggtgtggccagtcccagctgccgtcttaaagcagatgtgcgcaacagtgta
caggcacacctgccatagcaaattcctaggatacctcagtcctccatgttggtatgcttt
tcttttcaacaatgtggaaaatgcagtttaccaagaagcttttttggttttccttttaag
GTATTACTTCAAAAAAGCAAGCGATGAGTTTGCCTGTGGAGCGGTGTTTGAGGAGATCTG
GGAGGATGAGACGGTGCTCCCGATGTATGAAGGCCGGATTCTGGGCAAAGTGGAGCGGAT
CGATTGAGCCCTGGGGTCTGGCTTTGGTGAACTGTTGGAGCCCGAAGCTCTTGTGAACTG
TCTTGGCTGTGAGCAACTGCGACAAAACATTTTGAAGGAAAATTAAACCAATGAAGAAGA
CAAAGTCTAAGGAAGAATCGGCCAGTGGGCCTTCGGGAGGGCGGGGGGAGGTTGATTTTC
ATGATTCATGAGCTGGGTACTGACTGAGATAAGAAAAGCCTGAACTATTTATTAAAAACA
TGACCACTCTTGGCTATTGAAGATGCTGCCTGTATTTGAGAGACTGCCATACATAATATA
TGACTTCCTAGGGATCTGAAATCCATAAACTAAGAGAAACTGTGTATAGCTTACCTGAAC
AGGAATCCTTACTGATATTTATAGAACAGTTGATTTCCCCCATCCCCAGTTTATGGATAT
GCTGCTTTAAACTTGGAAGGGGGAGACAGGAAGTTTT
aattgttctgactaaacttaggagttgagctaggagtgcgttcatggtttcttcactaac
agaggaattatgctttgcactacgtccctccaagtgaagacagactgttttagacagact
ttttaaaatggtgccctaccattgacacatgcagaaattggtgcgttttgtttttttttt