Gene ALOX12 Variant 1
DNA : 14.65 KbNT_010718
mRNA : 2335 bp NM_000697
CDS : 1992 bp NP_000688
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  168 bp
acagccagtccccacagccggctctaccgctctgctcgcaggtttgggctagtctggggc
ggggacttgggagcgcctaaaacttgcgaggagggcggggccgcagaccggtcctttaaa
ggttggaagtggccccgaggcgccggcagccctgggcggtcccgggaatcgcacaggacc
CGGCTCCCCTCGCCTAAGCTGCTGGGGGGCGCCATGGGCCGCTACCGCATCCGCGTGGCC
ACCGGGGCCTGGCTCTTCTCCGGGTCGTACAACCGCGTGCAGCTTTGGCTGGTCGGGACG
CGCGGGGAGGCGGAGCTGGAGCTGCAGCTGCGGCCCGCGCGGGGCGAG
gtcagcgcggggagcgaggggagctagggcagcggggaccccgggcccaggcccgggccg
agctgggctcgcggcgggagggcgggaggctgggggcgaggtgacagcgcgacctcgcgg
actgggacttccacgaagctgggacgaggtgggcaagattagggacagggtccgcagctg
EXON 2  202 bp
tcctccacccgactccgggcgtctgagacccaaagagcaggttgtgcgggggcgggaacg
aggcgatgctgtctttggaggccctgagaaactgaggttgcacaggagcgcggctctgtc
ctcgaaacggcctcagtcgggtccctcctactaagtctggcctgggtccggcctgcacag
GAGGAGGAGTTTGATCATGACGTTGCAGAGGACTTGGGGCTCCTGCAGTTCGTGAGGCTG
CGCAAGCACCACTGGCTGGTGGACGACGCGTGGTTCTGCGACCGCATCACGGTGCAGGGC
CCTGGAGCCTGCGCGGAGGTGGCCTTCCCGTGCTACCGCTGGGTGCAGGGCGAGGACATC
CTGAGCCTGCCCGAGGGCACCG
gtgagcaggcggcgtcggggaaggaggcacaaggtctcgggaactgctgcggggctagga
gggcagagttaaggacggtcggagcagacttagaggatgtatgggcccagggcaggtgaa
atgtagggatcccagggtgctggacagaaaacgggaaggagttatgaattcccaaagttt
EXON 3  82 bp
aaagttggcaaagatgggataaacgtgtctggtggataatcaaatgaggcaaagccagag
ataaaagcaacagtgcatggctgaaaacatggaatacggctaaccacagggagatgagga
caagaggcgggcataggaccagacagagccgtgaggccaattgtcttgatgtctccccag
CCCGCCTGCCAGGAGACAATGCTTTGGACATGTTCCAGAAGCATCGAGAGAAGGAACTGA
AAGACAGACAGCAGATCTACTG
gtgaccacccaccccttaaactaaccccgccaccactgtcccaccccttccctgcccctg
cccctgcccctggccccatcactgaccatgacatccttcctgaagctttgtccccaactc
ctagctgggccacctggaaggaagggttacccctgaccatcgctgcagaccgtaaggatg
EXON 4  123 bp
gacatgttccagaagcatcgagagaaggaactgaaagacagacagcagatctactggtga
ccacccaccccttaaactaaccccgccaccactgtcccaccccttccctgcccctgcccc
tgcccctggccccatcactgaccatgacatccttcctgaagctttgtccccaactcctag
CTGGGCCACCTGGAAGGAAGGGTTACCCCTGACCATCGCTGCAGACCGTAAGGATGATCT
ACCTCCAAATATGAGATTCCATGAGGAGAAGAGGCTGGACTTTGAATGGACACTGAAGGC
AGG
gtgagaaaaaggctagacctcggagtgaaataagggctgggagggccaagaatgatgata
gacggtgagggactgagggatcagctgatgagttaagcctcaatacctgtcctagggctc
tggagatggccctcaaacgtgtttacaccctcctgagctcctggaactgcctagaagact
EXON 5  104 bp
ctacctccaaatatgagattccatgaggagaagaggctggactttgaatggacactgaag
gcagggtgagaaaaaggctagacctcggagtgaaataagggctgggagggccaagaatga
tgatagacggtgagggactgagggatcagctgatgagttaagcctcaatacctgtcctag
GGCTCTGGAGATGGCCCTCAAACGTGTTTACACCCTCCTGAGCTCCTGGAACTGCCTAGA
AGACTTTGATCAGATCTTCTGGGGCCAGAAGAGTGCCCTGGCTG
gtcagtggttccccgaggtctccataatcccttaatggcccctctggatgactcatcaca
ctccacagtcccccgtaactctttgcaagaagagaccttatcatatctggtcaactcaga
gaggccttgagaatgaaaacgcagaagctgggttcagggagggttatatacctgaacccc
EXON 6  161 bp
cccccgtaactctttgcaagaagagaccttatcatatctggtcaactcagagaggccttg
agaatgaaaacgcagaagctgggttcagggagggttatatacctgaacccctggggtaga
ttttggagaagggatatgcaggctgtggtacatatatcctcctttcaccgcccaccaaag
AGAAGGTTCGCCAGTGCTGGCAGGATGATGAGTTGTTCAGCTACCAGTTCCTCAATGGTG
CCAACCCCATGCTGTTGAGACGCTCGACCTCTCTGCCCTCCAGGCTAGTGCTGCCCTCGG
GGATGGAAGAGCTTCAGGCTCAACTGGAGAAAGAACTTCAG
gtacctctccttcccctgcctggcactgttctctccttagtagtgtggtgagaacggaca
gagagaatccaaactgagtcagaggaaggctgcagtactgcattgccccttggtgcagtc
ctgtgctggaaaaatacagaaataaaatatgtaggggaagaaactatgaggagctcccag
EXON 7  144 bp
agactgtttcttcactttaagatgagaggaactggaccaggggctctagttctcccaaca
gggctccggtactgatgcaggagaatggcaagaagctagactaaatctcttgccctttgc
cccggccccctgggggtagactttgaactctaaaaatggatacatccctcctgtccccag
AATGGTTCCCTGTTTGAAGCTGACTTCATCCTTCTGGATGGAATTCCAGCCAACGTGATC
CGAGGAGAGAAGCAATACCTGGCTGCCCCCCTCGTTATGCTGAAGATGGAGCCCAATGGG
AAGCTGCAGCCCATGGTCATCCAG
gtaagggccccagacctctcccacaacgttgcactctgttcacctcaacctctgctccca
gggacccaacccccagctcttggctcccaaaccccatcctcactcagtgagacttgtctt
catgtcactatttgcctgtaccctcgtctcccctgcctcatccaactagaattacttttt
EXON 8  210 bp
tccacctgacatcagggcactccagctagcgagcggcaggctgggagggttcacagtcct
cctgctagactataacctcctagaaggcaataatcttacttagtcatctctgtttcccca
agaatgctgactataatgtcatatacggaatgggagttcaataatttctctttctcccag
ATTCAGCCTCCCAACCCCAGCTCTCCAACCCCAACACTGTTCCTGCCCTCAGACCCCCCA
CTTGCCTGGCTCCTGGCAAAGTCCTGGGTCCGAAATTCAGATTTCCAACTGCACGAGATC
CAGTATCACTTGCTGAACACTCACCTGGTGGCTGAGGTCATCGCTGTCGCCACCATGCGG
TGCCTCCCAGGACTGCACCCCATCTTCAAG
gtacttattaatctattaaatcacatatccctcagaccccagagagaggaacagccccat
atcaaaagatattgcagcagcaaaaactctttgtagcaatttgtgagtgaagaggagact
gtctcaatatcttgagatgttgattttaattaagtttattaagtttagtcacttaacatt
EXON 9  87 bp
tccagggcccaactcacagggaagttggagagcacaagagtgagtgatcagaacagcagg
agatcagcctgtaaaggaaagcatcaagaggagaaggcgccatgctgggtgccaggccct
accaggaaggacccaagcatggcctccaccagtcacgccctccaatctcctcctctccag
TTCCTGATCCCCCATATCCGCTACACCATGGAAATCAACACCCGGGCCCGGACCCAACTC
ATCTCAGATGGAGGAATTTTTGATAAG
gtgaggagggtacggggcatgggactgcctcatccatctctccatgatctgccactttca
ggatccaagatcaactatgtgtgaatgtcctcactcttaacctatgaacctgtccctttt
atacccatgtcttttttttttttttttttttttttgagacagagtctagctctgtcgccc
EXON 10  170 bp
actgtgttggccagactggtctcgaactcctgacctcatgatccacccacctcagcctcc
caaagtgctgtatacccatgtcttaatatctgaaaatcccacatttgccccactttatgg
aagatgtgttggttctccagccctgtttccccctctaagacctgtgatctcctgtcccag
GCAGTGAGCACAGGTGGAGGGGGCCATGTACAGTTGCTCCGTCGGGCGGCAGCTCAGCTG
ACCTACTGCTCCCTCTGTCCTCCTGACGACCTGGCTGACCGGGGCCTGCTGGGACTCCCA
GGTGCTCTCTATGCCCATGATGCTTTACGGCTCTGGGAGATCATTGCCAG
gtgagtaaggaggagctgagaaatggtggggccggggggggggggggctctggcctgagg
ccagcatggggcaaaagcaagaaggtccagaaaggagaagcagagaactcaatcctgggg
agagatgaggaaaagtgaggacacagtgggtggctctgaaaatgaggagactgggatgag
EXON 11  122 bp
tcctagaactaaggacccacatcttccatgagatgctagtgtgtttagagggctgaggat
gtcccaaaggcgaggtgtcttcccagatactgtggaagcattgggcagatgccacagaaa
gaggaatagaggtcagaggcgggggctttctgccctcaagtgccttttccccctgggcag
GTATGTGGAGGGGATCGTCCACCTCTTCTACCAAAGGGATGACATAGTGAAGGGGGACCC
TGAGCTGCAGGCCTGGTGTCGGGAGATCACGGAGGTGGGGCTGTGCCAGGCCCAGGACCG
AG
gtaagatccattctagagacagaagaagctcctgggagactctgccagggcgccttccca
gccctgcccttctggggacaggaccccagcctctcatcacgcctcccttcctccctccac
acgggaaagcatgtgtatcccattcccacctcctccgactcaggacaattctagagaccc
EXON 12  101 bp
ctggcctatggtaactaagtgtaagtgactgagccaggacttaaacgcatgtctgatgca
aatacgtctaaataaaataaacaaattcatcaattctaaaatatgggcatcccaaaacaa
cagcctttgttcctctcctcttatgctgtagcttctaactgctattcctttcctgcccag
GTTTCCCTGTCTCCTTCCAGTCCCAGAGTCAACTCTGCCATTTCCTCACCATGTGCGTCT
TCACGTGCACTGCCCAGCATGCCGCCATCAACCAGGGCCAG
gtatggacagctgaaagcccaggtccctgaaggcaaggtgacctgagggagagatgggag
ttcaaaccctaagtaccagggttctagggttacagtttcttcctccagctggactggtat
gcctgggtccctaatgctccatgcacaatgcggatgcccccacccaccaccaaggaagat
EXON 13  171 bp
caactctgccatttcctcaccatgtgcgtcttcacgtgcactgcccagcatgccgccatc
aaccagggccaggtatggacagctgaaagcccaggtccctgaaggcaaggtgacctgagg
gagagatgggagttcaaaccctaagtaccagggttctagggttacagtttcttcctccag
CTGGACTGGTATGCCTGGGTCCCTAATGCTCCATGCACAATGCGGATGCCCCCACCCACC
ACCAAGGAAGATGTGACGATGGCCACAGTGATGGGGTCACTACCTGATGTCCGGCAGGCC
TGTCTTCAAATGGCCATCTCATGGCATCTGAGTCGCCGCCAGCCAGACATG
gtgagaggggactctcgggagagggaaatgacagttggaaaggaaacatcagagtgaggg
gctgggctctaggtgcgtttgtctttagaaactgactgatcctttgttctgtctcaggtg
cctctggggcaccacaaagaaaaatatttctcaggccccaagcccaaagctgtgctaaac
EXON 14  490 bp
gtccggcaggcctgtcttcaaatggccatctcatggcatctgagtcgccgccagccagac
atggtgagaggggactctcgggagagggaaatgacagttggaaaggaaacatcagagtga
ggggctgggctctaggtgcgtttgtctttagaaactgactgatcctttgttctgtctcag
GTGCCTCTGGGGCACCACAAAGAAAAATATTTCTCAGGCCCCAAGCCCAAAGCTGTGCTA
AACCAATTCCGAACAGATTTGGAAAAGCTGGAAAAGGAGATTACAGCCCGGAATGAGCAA
CTTGACTGGCCCTATGAATATCTGAAGCCCAGCTGCATAGAGAACAGTGTCACCATCTGA
GCCCTAGAGTGACTCTACCTGCAAGATTTCACATCAGCTTTAGGACTGACATTTCTATCT
TGAATTTCATGCTTTCCTAAAGTCTCTGCTGCTAAGGCTCTATTTCCTCCCCCAGTTAAA
CCCCCTACATTAGTATCCCACTAGCCCAGGGGAGCAGTAAACTTTCTCTGCAAAGACTAG
ATCCTTTTTTACGCTTTGCAGACCGCATAGTCACTGTCTCAACTACTCAGCTCTCCTGCT
GCAGCATGAAGGCAGCCACAGACAACATGGAAATGAGTGTGACTATGTTCCAATAAAACT
TTATGGACAC
tgagatatgaatgttacatcacaaagtagtcttcttttggtttattcaaccatttaaaat
gcaaaaaaaatccacaaacaaatgtgctttgtttgagacatgcacagccaggctacagac
tggatttggcccttgaaccctgcactagcctgaggccctgaccctacttccaaaacatcc