Gene AATF Variant 1
DNA : 107.91 KbNT_078100
mRNA : 2057 bp NM_012138
CDS : 1683 bp NP_036270
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  259 bp
tctcagcgacagaagcggtcacgtgccttggcgcgcttccgcaccgccccttcccgcgca
ctcgcacgcgcacgcgcacacgcgcccatacggctccaatcccttcaaccttctgcgcgc
ttccgccttcatgctagcaacgcccgcagtgacgcgcaggccccgccccctcccgcgcgc
CTCCCGGAAGTGGCCGGTCCAGAGCTGTGGGGTGGCCTCCGCGCGGTCTCTGGCGGAGTC
GGGGAATCGGATCAAGGCGAGAGGATCCGGCAGGGAAGGAGCTTCGGGGCCGGGGGTTGG
GCCGCACATTTACGTGCGCGAAGCGGAGTGGACCGGGAGCTGGTGACGATGGCGGGGCCG
CAGCCCCTGGCGCTGCAACTGGAACAGTTGTTGAACCCGCGACCAAGCGAGGCGGACCCT
GAAGCGGACCCCGAGGAAG
gtgaggccggactggggcaggccacgtgcggagcggtgggccaggccctgtggggcaagg
gggcggcgtgggaggggcgtgcgcgaggccgccgggcctgcgctccttcgcttggcgcag
aggaacgtcgcctcccgcgagggtggtcccggcctcgggaggagggcttcggcttctttt
EXON 2  192 bp
tgtttagaaacagcagtaagacagtgttctactttgggagagagtgaatttcctattcct
ggaagttggtggggatttcgtaaaggacgttcaactatgagataaatgggtcgaccaggg
ttcccgttaaagtttctgctaacctggagattctgtttacttttccctctcccccgacag
CCACTGCTGCCAGGGTGATTGACAGGTTTGATGAAGGGGAAGATGGGGAAGGTGATTTCC
TAGTAGTGGGTAGCATTAGAAAACTGGCATCAGCCTCCCTCTTGGACACGGACAAAAGGT
ATTGCGGCAAAACCACCTCTAGAAAAGCATGGAATGAAGACCATTGGGAGCAGACTCTGC
CAGGATCGTCTG
gtgagtagacatttttgaatggaactcttctcttccctaattttttcagggttaaaatcc
tccggtcatcccccatgatctttgcaagagtagtctgcggatcttttttttgagacagag
tttggctcttgttgcccaggctggagtgtgatggcgccatctcggctcaccgcaacctcc
EXON 3  411 bp
tctttgcttctcccttagcattttggagattgtagatgtgtaataaatatattgttgaat
tgagtgcagtaagagattttccccctgatgccacagtgcttaagttgaaatgaagtctat
ggcttggtattttctccaggtaatacccatttttctctttcttccctctcttctttgtag
ATGAGGAAATATCTGATGAGGAAGGGTCTGGAGATGAAGATTCAGAGGGACTGGGTCTGG
AGGAATATGATGAGGACGACCTGGGTGCTGCTGAGGAACAGGAGTGTGGTGATCACAGGG
AGAGCAAGAAGAGCAGAAGCCACTCTGCAAAAACACCGGGCTTCAGTGTCCAGAGTATCA
GTGACTTTGAGAAATTTACCAAGGGAATGGATGACCTTGGGAGCAGTGAGGAGGAGGAAG
ACGAAGAGAGTGGCATGGAAGAAGGGGATGACGCGGAAGACTCCCAAGGCGAGAGTGAGG
AAGACAGGGCTGGAGATAGAAACAGTGAGGATGATGGTGTGGTGATGACCTTCTCTAGTG
TCAAAGTTTCTGAGGAAGTGGAGAAAGGAAGAGCCGTGAAGAACCAGATAG
gtttgtacatggttttgctgattgcctgtttttcaaagtatctgcatttggtctactttt
catttgtttgtttttggctattctctatctcctgtgtcctttcaattagtttgtgacatg
ccccacttacccagaagcctaaagccctattcctgtatgcttagccagccatttctgcac
EXON 4  138 bp
cttgcttcatggatactgaatttattttctctaatagagaatatttgtttccatggcatt
aaactgctaaagctgtggtgcttagagactggtgtggtttcctgttcttccccacccctg
ccacctcacccccagaatattttattattgaggaatgggattctcttttcttcttttcag
CACTGTGGGACCAGCTCTTGGAAGGAAGGATCAAACTACAAAAAGCTCTGTTGACCACCA
ACCAGCTTCCTCAACCAGATGTTTTCCCATTGTTCAAGGACAAAGGTGGCCCAGAATTTT
CCAGTGCCCTGAAAAATA
gtaagaatacttatgtcctgttggaatacttagaaccactttgtcaaatgaagacagctt
tgattgaagtggactgggagcttgagccatgtttattgtgctttcttctcatctgccctt
gctctcccctccccatcccccttggctttccaagttgcttttttttttttttttttttga
EXON 5  115 bp
aggcaacgttgttatttccatttgggaatatttcagagagtatttagttcctgtgtgtat
cctgtgcctccccttcactccccacagccagaactgctcaggagtcatgagttataggca
tcacctactttggagaattgtagataattaattgtcctttctctgtcctttatttcccag
GTCACAAGGCACTTAAAGCATTGTTGAGGTCATTGGTAGGTCTTCAGGAAGAGTTGCTTT
TCCAGTACCCAGACACTAGATATCTAGTAGATGGGACAAAGCCCAATGCGGGAAG
gtaagagaacagaatcatggagttgcttattttcttttcatttggatagtttcccatcat
ttatgaaagaaaagctaagttctcttcaggcagatattaatgttagtaaaatagagtctc
atatttacctgatggtcaggatggcacataagttggtgattagattttagatttttatat
EXON 6  202 bp
gattgatctcatgaatattcttctcaaagagcaaaagccatccttatatctttggtgtta
ttttgaatggagacagaacaggtaaggcctaaatattctcagtcctttatgtgagcctag
tttttaaaatctaagtaatgtttgtttacactggacataatattcttactgcttttctag
TGAGGAGATTTCTAGTGAAGATGATGAGCTGGTAGAAGAGAAGAAGCAGCAACGAAGAAG
GGTCCCTGCAAAGAGGAAGCTGGAGATGGAGGACTATCCCAGCTTCATGGCAAAGCGCTT
TGCCGACTTTACAGTCTACAGGAACCGCACACTTCAGAAATGGCACGATAAGACCAAACT
GGCTTCTGGAAAACTGGGGAAG
gcaagtgtgtgtatgcgcgcatgtatgtgtaagataggttgtggcaacttgaagaagttt
taagaaattggaactacagctcatttatatggatgttgtcacgatgtaatggtaatcatt
catttctatagcaaaatctactgaacttctggcactggggtttatacgattcagacttgg
EXON 7  165 bp
actaactttttttttttaagaacaattatagccactcacaaactcagtcctttacagaaa
gtccctcctgaaaagatgattttctatctctctgctgacacagaaagatagagaaaccaa
tgtagcttgccttcagcactgattttctgcattatctgacactgcttaatgttgttgcag
GGTTTTGGTGCCTTTGAACGCTCAATCTTGACTCAGATCGACCATATTCTGATGGACAAA
GAGAGATTACTTCGAAGGACACAGACCAAGCGCTCTGTCTATCGAGTTCTTGGCAAACCT
GAGCCAGCAGCTCAGCCTGTCCCAGAGAGTTTGCCAGGGGAACCG
gtaagaactctgtaatgcagagtgattatggggaatagtttctatgaggcttattagctg
aaaaacttgtagctattacctgtttatataagaggttagtgagagaaaggaaagcaacac
tactttactggattactgagagaaacttgagtgtatgtgagaggagagagtttttaaaaa
EXON 8  84 bp
caactgcctgttaatgtttttgcctgttttcatattggactgttttgttttttaatttta
agaactttttatatcttaaggaaaacagtgctttgactgttctacatattatttatagta
gctacattagttagatagccttgttgggattcactcttttcttactcattgttaacatag
GAGATCCTTCCTCAAGCCCCTGCTAATGCTCATCTGAAGGACTTGGATGAAGAAATCTTT
GATGATGATGACTTTTACCACCAG
gtgagacttttacactctcttgttacaaatcatgttttagcattttaaagcagcttatag
aattctctgaacaaagaagttgcttattttggaaggatagagtcagacagtgagttagaa
ctcccgcgttcaaaattgacttacagtgtcattgtggatttgttgcttttcttctatttt
EXON 9  68 bp
aagatatataactatgaaagcgttaacgggaattcagtaatgctcttgccactgggttgt
cccttattgattgtagttttagagctgtcactatgccattcagaattccttctctgccct
tttaaagtcagttgtactggaagatgataaataaattcgttgctttcctttttcccctag
CTCCTTCGAGAACTCATAGAACGGAAGACCAGCTCCTTGGATCCCAACGATCAGGTGGCC
ATGGGAAG
gtaatttagatacagctttctgttcatgcaagcagcctatgtaatagtttctccccttga
gtccctttaattctacctgcaaagcaatgattggtcctataattattgaagttaagcaag
taagagctagaaagaaaatgtgactaattgtttaccctacattgcctaaagtgcaatttg
EXON 10  81 bp
tttttaccattgcacaaatcctgttcaattgattagtcagtttggccccaaactagcttg
aggaacttgatgtaggttgatgatttctttctgcagggttgttagaataattccaatttg
tcaatatgtataactatttctgttagtgatgatgcataacattgcttgtgaattttccag
GCAGTGGCTTGCAATCCAGAAGTTACGAAGCAAAATCCACAAAAAAGTAGATAGGAAAGC
CAGCAAAGGCAGGAAACTTCG
gtgagttacttttcggaaaaaatgtcaacatatattgtatatgtatctcgtctcttacat
tctggctgttatgtcatttttctttttcttctgatgattctgtttttaaggatcagaaaa
ataaacaatatttgaaggtttattgcaactcagtttttcttattctaaaatggaaatata
EXON 11  72 bp
ggatgactgtagttggtcatcccaatgacagtggtaagtgcctatgaatttttccctatc
ccactttgtacccagatgttccagtgatcagttctggagtttgttaactcactgaatgtg
tttcctctcctaggttaatagttactaatgttgctgcctgttgcttcctgctttatttag
GTTTCATGTCCTTAGCAAGCTACTGAGTTTCATGGCACCTATTGACCATACTACAATGAA
TGATGATGCCAG
gtgagtaatagattaattatgtgtctcaaatggcttcatgacagcctgatattgacctgc
tctacagccttcgccctctccatttcttcttatcagttaaccatttgtcattggcatcgc
agtaagggtcacatctcttcaccctcataattactataaaaccaaaccaaaaacttgcat
EXON 12  270 bp
tttgattgggtttcttccttctgttgtatttgtgagtaagagctgtggggtgcattttta
attacatggctgtgttttcaacagaagaaacagaatggggtattttccagcttctgcgtt
cctttttaaccttgaatagtgaaccagtgtgttaaccagtttgctgtgtttgtcttttag
GACAGAACTGTACCGCTCTCTTTTTGGCCAGCTCCACCCTCCCGACGAAGGCCACGGGGA
TTGACATCGCCCACCTCCGACACCCAGTGGGCGCCTTGGCTGGTGCGGCTGCTGGTCCAG
ATGGAGGAAACCAGTGACTTTATGGGGCTGAGCTAGTAGGGAAGCCCCTGGAAAGATGCT
GCGTTCCGAACCTGTGCCTAATACACGCAAGGGCGCTGTCCCGCCCAACCCCGCCTTTAA
ACGCCACAAATAAAGAGCATTGTTACCGCC
accaccgcttgtgatttcttaagaggctgagagtcagtctggtttggttctagtggatga
cacatttactgagcttttttttttctagtccagtggcctcctcatacaatgtcagacttg
acgtttccttgacccactcaccctggcggacatgtagattgtttgcatagcgtggctgtt