--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (58038 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1280       1343   0    Initial     64    84        Good
cgcgccagttgccagggagcggttgccatagagctgagcagttgtccgcgtgcgcaggcg
gaagtcccggattgaggcgccgccatttttgctgcccggacgcggagcgagaggctgaga
gagtcggagacactatccgcttccatccgtcgcgcagaccctgccggagccgctgccgct
ATGGATGATCGAGAGGATCTGGTGTACCAGGCGAAGCTGGCCGAGCAGGCTGAGCGATAC
GACG
gtgagttgggggggcaacggggggctggaattctcggaccctctgccgccgcccacagag
gccgggaacaggagacaaaatggcggcatcgtctgcgagcctggcccgggggcttgggtt
cgggaagcaggaaatggcctgggagctcccggggcgatgggaggctctatgccctggaat

Exon  2 +       1812       1919   0    Initial    108    64    Marginal
ggggcgggggagggggaggagatggcgggtgctgtctccgaacgagccaccctcatggga
gcttctgggacggccttgggatgtggagaacaattgggtggggtgacgggggaagcagca
cccgccacatgggagagagcgaagaccgggagctgtagcgcgggcgcctttcagggaaat
ATGGCGGGTGGGGGCGGTGGCTTTTCCCCGGAGGCCCCGTGTGGGGCGGCGGCCGTGGAG
TCTCACAAAGGAGGACCTTTGAGAGCGATGGGCTTCCTCAGGCCTGAG
gtgggggacagtcgtggatgatggtggggggagaggggtgagtgggaatcactgcagttc
gtcttcgggcggtggcaggctcccatgctgcgatcgggtttctttcccgtaggccggcac
ctcgtagtgaggggtttcggggcttttcctcctcgtcgtcttctggggaggcccagaaaa

Exon  3 +       4848       4879   2   Internal     32    51    Marginal
acccgggaggccgaggttgcggtgagccgagattgcgccattgcactccatcctgggcaa
cagcaacaataaaaaacggggaatatagaggggaaaagtttacccgtttttggggagcag
aggggtaacataaactacatttgggcttgtggggctgttgttggttttgtcctttcctag
TCTCTTCCCTATCAAGATTGGCTTCATGGAAG
gtaggatgaagttttgatggtcatgttggattccctaggaatgcatctgttgagtcattt
acttgagagctgtcttttttttcttttgagacggagtctcgctctgtctcccaggcttta
ttgaagtggcacaatctcggcccactgcaacctccgcctccagggttcaagcgattctcc

Exon  4 +      31301      31409   0   Internal    109    61    Marginal
ctgtggtcccagctactcgggaggctgaggcaggagaatggcgtgaacctgggaggcgga
gcttgcagtgagccgagatcacgcccaggcactccagcctggtgacagagcgagactccg
tctcaaaaaaaaaaaaaaaaaaaaaaaaaagtttttctgtgggtaaatgctgtccaacag
CGTCAGATGCTACAGAGAAATCATGCAGGAAAGGAAAAGCCCATCAACATGGCAGACTTC
ATTGTCTTGCCACGGCCACTCCAGCCTTCAGCAGCCATCACCCTAAGCA
gtcagtagccatcaacatcaaggcaaaaaccttccaacagcaaaatattatcacttgctg
aaggctcagatgagcattagcatttattagcaataaggtgtttttaaattatgtacagtt
tagacataatgctgttgtacacttaatagattacagtgtagtttaaacataacttttcta

Exon  5 +      36332      36531   1   Internal    200   100   Excellent
cttagtttggtttcctttacatgtttttggctttttactcatattagttttgatgattat
gaaattatttttgttaaaatgtttttttcgcagtagcttgacagaaaaaaactactttga
aaggaatatgttaagaaaacttcaaatttgtaaggtctgacttttccttttcccatacag
AAATGGTGGAGTCAATGAAGAAAGTAGCAGGGATGGATGTGGAGCTGACAGTTGAAGAAA
GAAACCTCCTATCTGTTGCATATAAGAATGTGATTGGAGCTAGAAGAGCCTCCTGGAGAA
TAATCAGCAGCATTGAACAGAAAGAAGAAAACAAGGGAGGAGAAGACAAGCTAAAAATGA
TTCGGGAATATCGGCAAATG
gtgagattgttgtgccatcatccccccttatccacagtttgagttacctgtaggacggta
cacttaagattttgagagaaaaggagactacattcatataacttgtattacagtatgtta
taatgtttctgatattgatctttgtgcctggtttataagttaaacttacccgtggctatg

Exon  6 +      39382      39488   0   Internal    107    97   Excellent
tttataacctagaggcagcttttctctgcttttgtgtcaagaaggaagaagggagtttgg
agagggatacaaattctttttaatactaagctctctacctcaaaaccagagatagaatat
gtaataatttgtagaatttctagacttaatctgatttaaaaaaaatttttttttttttag
GTTGAGACTGAGCTAAAGTTAATCTGTTGTGACATTCTGGATGTACTGGACAAACACCTC
ATTCCAGCAGCTAACACTGGCGAGTCCAAGGTTTTCTATTATAAAAT
gtaggttctatactagaagggaaaatgtaagattgaaagttggtccttttagaaccataa
ctttgttctatgtaggttttcaacttttatttaagaataattgttcaatgttagaaggat
agttaatattgtaatgaaaaggtggttgggctattatgaaaatgtattagcttttgctta

Exon  7 +      40092      40298   2   Internal    207   100   Excellent
gaaaaaaatgaaacgaagccagttattcctgagagtgtttaaaattattgaagtacacct
aattgttacatatatttttgtcacattttatataatatagaacaattttagcttattttc
ctttaaaaatcgttcctagtttaaattttttttttttttttaattttggttttgttttag
GAAAGGGGACTACCACAGGTATCTGGCAGAATTTGCCACAGGAAACGACAGGAAGGAGGC
TGCGGAGAACAGCCTAGTGGCTTATAAAGCTGCTAGTGATATTGCAATGACAGAACTTCC
ACCAACGCATCCTATTCGCTTAGGTCTTGCTCTCAATTTTTCCGTATTCTACTACGAAAT
TCTTAATTCCCCTGACCGTGCCTGCAG
gtaagttgtggggaagaacagcagcgctcagcgtgaaagttaaggggggcgctgtttggg
ttttccgtgttgtttcttgggcctgtctttgtagacttggctgcatagtaattcttttgg
ctcttactgaaactactttggatagtattaaaacagacctgtctcaacccactagcatag

Exon  8 +      47043      47179   2   Internal    137   100   Excellent
gtaagaagtagtgttccacatacctttaagttaatttttattgtatttgctttttctttg
cattatcattgtgactattacaaactggaataactgaagaaaagattgctgtctagcatg
tcatttctaattctgattttggacttaatttttataacacttctattgaaatacctttag
GTTGGCAAAAGCAGCTTTTGATGATGCAATTGCAGAACTGGATACGCTGAGTGAAGAAAG
CTATAAGGACTCTACACTTATCATGCAGTTGTTACGTGATAATCTGACACTATGGACTTC
AGACATGCAGGGTGACG
gtaagcaagcacggagtgaaacaggcacctctttcagttgcaggatttgtttgtactctc
tttagacattccttggcttgtcgttatatcaagctagaatttagattcaccgcctgccct
ctatgaaattgtaattgctgcctttataggaaatggtgctacagtacggagttccatttt

Exon  9 +      55891      55943   1   Terminal     53    96   Excellent
ataatcccttcttggcttaggcatctcaggtgtcaaggatgatagaagtcctttgcctgc
gtttaataccaattgtagcaagtagaagagtctttatgcttggaatgacacctttgtttg
tggctgccatagcctaatgtagtcaatacgaaataattgactttttttcttttttaacag
GTGAAGAGCAGAATAAAGAAGCGCTGCAGGACGTGGAAGACGAAAATCAGTGA
gacataagccaacaagagaaaccatctctgaccaccccctcctccccatcccaccctttg
gaaactccccattgtcactgagaaccaccaaatctgacttttacatttggtctcagaatt
taggttcctgccctgttggttttttttttttttttttaaacagttttcaaaagttcttaa

--------------------------------------------------------------------------------