--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (17519 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1310       1444   0    Initial    135    89        Good
ccctagcctgcggtgcgccgtgctttggccccgcaggccccgcccccggccccgccccgg
cgcgcgcccggcccgcctccctaggcgtggaggagggggggcggctcagccccgcgcccg
tgcgcgcgctcgcggccgggttgcagggctgggcgcgcgccccgcgtcccgggcaggaag
ATGGTGGCGAGCGCGCGAGTGCAGAAGCTGGTGCGGCGCTACAAGCTGGCGATTGCCACG
GCGCTGGCCATCCTGCTGCTGCAGGGCCTGGTAGTGTGGAGCTTCAGCGGCCTGGAGGAG
GACGAGGCGGGCGAG
gtgctccgacggccgggcgggcgggcaggccgggcgcgggggcgcgcggggtcctggcgg
ggctgcgggcggccccagccggggaagtggggcacgggccgcgtgcgtgcgtgcggggcg
ccggcggtcgcccagagcggagcatccggcccccggcactcccttccccagcaggcctag

Exon  2 +       9097       9291   1   Internal    195    84        Good
ctgagagcccaggagtgcccgtggccaaggtggtacgggcagtaaccagccggcagagag
ccagccggcgggtcccacctgccccacccccggaagccccaggccgccagaacctgagtg
gggcagcagctggggaggcgctggtaggggcagctggcttcccaccacacggagatacag
GGAGCGTGGAGGGCGCCCCCCAGCCCACGGACAATGGCTTCACCCCCAAGTGCGAGATCG
TGGGCAAGGACGCACTGTCTGCACTGGCCCGGGCCAGCACCAAGCAGTGCCAGCAGGAGA
TCGCCAATGTGGTGTGCCTGCACCAGGCTGGGAGCCTCATGCCCAAGGCTGTGCCCCGGC
ACTGTCAGCTGACTG
gtgagggacaggggtgctccagcccttcccaggcgggggcaggggggtggcatggcccgg
atcctcacccctatctctctgaggaagaaagagccaaggggatcctacctccctgcctaa
gtcttcatccagtgtacttactaagtggcagaggcagagtggggacccacgagcatggag

Exon  3 +       9577       9752   1   Internal    176   100   Excellent
tacctccctgcctaagtcttcatccagtgtacttactaagtggcagaggcagagtgggga
cccacgagcatggagctccaagtctaggtttcttcggaaggcaggcagctccctcttccc
atctcacccccaccctgtgacctagggtgggcctcgccaacgcctgtcctctgctctcag
GGAAGATGAGCCCCGGCATCCAGTGGGATGAGAGCCAAGCCCAGCAGCCCATGGATGGCC
CCCCGGTGCGAATCGCCTACATGCTGGTGGTTCACGGCCGCGCCATCCGCCAGCTGAAGC
GTCTCCTCAAGGCCGTTTATCACGAGCAGCACTTCTTTTACATCCATGTGGACAAG
gtactgtggtggggagaggccaaggggtctgggatgagcagagcagaaacagaaggttgc
agacagacagagtctctgacctggcccaggtagcctaggagggaaactgaggccctgaac
aggggagtggcagcacgagccagctcagccgcttaggggctggagccctgccctgtgctt

Exon  4 +      10023      10225   0   Internal    203   100   Excellent
tagcctaggagggaaactgaggccctgaacaggggagtggcagcacgagccagctcagcc
gcttaggggctggagccctgccctgtgctttcctcgtcttgtgtcccttcactctgtcct
ggggtgggattggggatggcgataacactggaggctagctgagtgtctcctccccaccag
CGTTCCGACTACCTGCACCGGGAGGTGGTGGAGCTGGCCCAGGGCTATGATAACGTGCGG
GTGACGCCCTGGCGCATGGTTACCATCTGGGGCGGGGCCAGCCTCCTGAGGATGTACCTG
CGGAGCATGCGGGACCTGCTAGAGGTGCCTGGCTGGGCCTGGGACTTCTTCATCAACCTC
AGTGCCACTGACTATCCAACCAG
gtgtggggatggggctctgagtcctctgcatgggaggggacccctgtctgggcacctggg
gttggagggctttggtggaccttctctgccccataagcgtaactctgggatccgccctgc
tcagacatgggcccctgggccccagctatgttttaggggaggggttggtgtaagatgatc

Exon  5 +      10670      10750   2   Internal     81   100   Excellent
aggaaggatggggtggtcttcctcaggggcctctggtgctcaccaccccagacatcagcc
aggggtagggcacatggccagccagcaatcaggcagagaagaaaagccagaaggtccgct
ctgggccagtgactgagcaactatctcatgtggctgcctgtcaccccattccttcaccag
GACCAATGAGGAGCTGGTGGCATTCCTATCCAAGAACCGGGACAAGAATTTCCTCAAGTC
ACATGGCCGGGACAACTCCAG
gtgagggggtggggaaggaggccctggccccagagtcttgtcccaacccctcccacacag
ttgggctcggtggctccagccctgggtttcaaagcctccacaccagtcacaggttgagga
gtgttggttgccaggcgggtgaaagagcttagaccccaccctgcaggatccccagccatg

Exon  6 +      10950      11166   2   Internal    217   100   Excellent
ggccctggccccagagtcttgtcccaacccctcccacacagttgggctcggtggctccag
ccctgggtttcaaagcctccacaccagtcacaggttgaggagtgttggttgccaggcggg
tgaaagagcttagaccccaccctgcaggatccccagccatggcctctctgctgcccacag
GTTCATCAAGAAACAGGGCCTGGACCGGCTCTTCCATGAGTGCGACTCACACATGTGGCG
CCTGGGCGAGCGGCAGATCCCAGCAGGCATTGTGGTGGATGGCGGTTCTGACTGGTTCGT
GCTGACACGCAGCTTTGTGGAGTATGTGGTGTACACAGATGACCCGCTTGTGGCCCAGCT
GCGCCAGTTCTACACATACACACTGCTCCCAGCCGAG
gtgggtagcccagcaggcatgaaggccagggagggcgtgggttgggctgcctgcagctca
ccttccactctcccttgctgcttgcagtccttcttccacacggtgctggagaacagcctg
gcctgtgagaccctcgtggacaacaacctgcgggtcaccaactggaaccgcaagctgggc

Exon  7 +      11283      11430   2   Internal    148   100   Excellent
cacagatgacccgcttgtggcccagctgcgccagttctacacatacacactgctcccagc
cgaggtgggtagcccagcaggcatgaaggccagggagggcgtgggttgggctgcctgcag
ctcaccttccactctcccttgctgcttgcagtccttcttccacacggtgctggagaacag
CCTGGCCTGTGAGACCCTCGTGGACAACAACCTGCGGGTCACCAACTGGAACCGCAAGCT
GGGCTGCAAGTGCCAGTACAAGCACATTGTGGACTGGTGTGGCTGCTCCCCCAACGACTT
CAAGCCACAGGACTTCCTCCGGCTGCAG
gtgcttgcccgaggccccaaggcccctggctaggtcttctcccctggcttttcaccagga
aaatggcagggtgggccagtaagagaatctggggggccacggcctgcagcaaccctcagg
ggtctggggctacaacagcagcaggaaaagccgcaggaggctgagctctaggcagtgctg

Exon  8 +      11680      11942   0   Internal    263   100   Excellent
ggtgggccagtaagagaatctggggggccacggcctgcagcaaccctcaggggtctgggg
ctacaacagcagcaggaaaagccgcaggaggctgagctctaggcagtgctgaggggccag
ccccaccatgccctctggggcttccagagcccttcaccctccttgcctctcccactccag
CAAGTCTCCAGACCCACCTTCTTCGCCCGGAAGTTCGAGTCGACTGTGAACCAGGAGGTG
CTGGAAATCCTGGACTTCCACCTGTATGGCAGCTACCCCCCCGGCACGCCAGCCCTCAAG
GCCTACTGGGAGAACACCTACGACGCGGCTGATGGCCCCAGTGGGCTCAGTGATGTCATG
CTCACTGCTTACACAGCCTTCGCCCGCCTCAGCCTGCACCATGCCGCCACTGCTGCACCC
CCAATGGGCACCCCACTCTGCAG
gtgagacccccttctgacatacagcaggcccttggggtgtggtgccctagggggaggcca
accagagagtgacgtcccctgcccacaacaaggccccagtctgaagcagggaaaaatgca
aataccgaaaagacggctagagccaggcatgcaggtgctgtgggggtgagatctggggaa

Exon  9 +      12226      12421   2   Internal    196    96   Excellent
aagcagggaaaaatgcaaataccgaaaagacggctagagccaggcatgcaggtgctgtgg
gggtgagatctggggaaaggaagtgcctggggatgggactccccagagccccctccctgg
gactccaggccaagtcaggtgtgctgatggcatctccctttctccctgctggcaccttag
GTTTGAGCCCAGGGGCTTGCCGTCCAGCGTGCACCTGTATTTCTATGACGACCATTTCCA
GGGCTACCTGGTGACGCAGGCGGTGCAGCCCTCAGCCCAGGGGCCGGCAGAGACGCTTGA
GATGTGGCTGATGCCCCAAGGGTCGCTGAAGCTGTTGGGGCGCAGTGACCAGGCCAGCCG
GCTCCAGAGTCTGGAG
gtgggacaggtcccccacttgctttctcccaacccccacccagacttggggtagtgggaa
gagagggacagacaccaagggaggggtaaggttatttttcccagtcatggcagccatggt
gatgcccccatgcagacatcctgtgtcaccccccagcctgtgcacactgaggagcacctc

Exon 10 +      13376      13709   0   Internal    334    93   Excellent
tctcagagctgggagagatattaaaggtctcctagtctgaccccttcattttgcagatgg
ggaaactgaggcccagaaagagacagtgactggcctgagattacacagtgagaggcagct
tcagaggagggagaaggacctttcccccacactcctgcccagctgcctctctctctacag
GTTGGCACTGATTGGGACCCCAAAGAGCGTCTTTTCCGGAACTTTGGGGGGTTACTGGGG
CCGCTGGACGAGCCTGTGGCCGTGCAGCGCTGGGCCCGGGGCCCCAACCTCACAGCCACA
GTGGTCTGGATCGACCCAACCTATGTGGTGGCCACATCTTATGACATCACAGTAGATACG
GAGACTGAGGTCACGCAATACAAGCCCCCACTGAGCCGGCCCCTGCGGCCAGGGCCCTGG
ACTGTTCGACTCCTTCAGTTCTGGGAACCGCTGGGTGAGACCCGCTTCCTTGTGCTGCCC
TTGACCTTCAACCGCAAACTACCTCTCAGGAAAG
gtaagcgtgcagttctcaaatgaggcccagaagccagacagaataggactcgccagagag
gtgacctcaagaagccaaccatcagagctgactcccatccctagagtcagggaagcatgg
aagggctggggccttcatcttctttcctgtagcatgcagggtcctgcactgcagtgtggt

Exon 11 +      15138      15460   1   Terminal    323    69    Marginal
ttataaaactcagttttataggcacagaaagtcccttggattagcccaaggtcattcagc
aagctgtgactcagaagtagggctgtgacaggaactggggtacccagacccaactcctgg
gtctggcctccacggagtctgttgcagggggtgtgcttactgcctgctctgcacccacag
ATGATGCCAGCTGGCTGCACGCAGGGCCACCCCACAACGAGTACATGGAGCAGAGTTTCC
AGGGCCTGAGTAGCATCCTGAACCTGCCTCAGCCGGAGCTCGCGGAGGAGGCTGCCCAGC
GGCACACACAGCTCACAGGCCCTGCGCTCGAGGCCTGGACAGACAGGGAACTGAGCAGCT
TCTGGTCCGTGGCTGGACTGTGTGCCATAGGCCCCTCTCCCTGCCCCTCCCTGGAGCCCT
GCAGACTGACCAGCTGGAGCTCTCTGTCCCCCGACCCCAAATCAGAGCTGGGGCCTGTCA
AAGCAGACGGGCGACTCAGGTAG
cagggccccagccagtacccgtggaggacccgggaaattgcaccttacagacagtggagg
ggtgtcccctcccacaggcaagaaccagaggcccaggctgcacacccatttcagccatca
agaacccacacagacggcagggaaggtggacacagtatgaactactgctgatgtctctgt

--------------------------------------------------------------------------------