--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (27869 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1238       1314   0    Initial     77    89        Good
cggtggggccaatggggcggggggctcgccgcccggggctggggagcctcccaatctcct
cctttcccagcgccgcctgccccgccccacccgggtttaaagtcccgcgggcgggtggtg
gcggagctgcgagcttgagcggcgcgaggagatgctagagggcgcagcgccgccagcacc
ATGCGCCCCCCGCCCGCGCTGGCCCTGGCCGGGCTCTGCCTGCTGGCGCTGCCCGCCGCC
GCCGCCTCCTACTTCGG
gtcagtgcccgccgcgccccccgcccgctccccggcctgcctgtctctccctcctgcgct
acagctgggccaatttttccctcccgctgtccttggccccgccgaggtctcgaactcaga
ccctagcccggcgcgacccaacccacttcgcagtcggagttcgcgccctgagttcggtct

Exon  2 +       5578       5600   0    Initial     23    45    Marginal
acagattctcctgcctcagcttccccagtagctgagattgcaggcatgtgccaccatgcc
tggctaatttttgtatttttagtagagaccatgttgatcaggctggtctggaactcctga
cctcaaatgatccacccacctcagcctcccaaactgctgggcttataggtgtgtgccacc
ATGCCCGGCCCCCAGTCCAGTCT
gtaagttatccgagtggctttgtaactagaaatagtttctgtggatgcaagtttttaaat
cataattaactttggtgatgtttcttcagtgtgtgacctctgcactggttgagtttcttt
cctctctagggatagtacagagaagtttatgaaagcccaagacagtgaatcccagctttg

Exon  3 +      13016      13133   0    Initial    118    55    Marginal
cagcgaagccagcagggtgggactgcagggaggctgagggacagccccgaactgcactcc
ttgcgtggggttagacacctaaggggcataatatgcagccagcaggtgtctgtagagcat
ctgcttgggaggagcacgcatctggactgggaaagaatggatctcagggtatgaaaaacc
ATGGCCTCTGCCAAGGAGCTTACAGGATACAGCTTTGAAGAGGAAGAAAGGAGTGTCTGC
CATGCGGAACTGATGGTACTATATATACAAAAGTGGGAGAAGACAAAGAAAGAGGATG
gttagagggggatggggctggcaagtaaggagggcttcctggaggaggcaaacaaacatc
acagcatactagagctgtctgggacctcggggtgatcaaatgttaaaaaaggacatggct
ataaaaggttccagggtatccatgagggcttttggactgggagaaggttacagcatgggg

Exon  4 +      22201      22372   0   Internal    172    82        Good
cagtaaatgaagcccctgaggaggccccttcccttcatttgcccctcaccaccatcccca
aggctcacctgtctccctcctctcgctctctctagcctgaccgggcgggaagtcctgacg
cccttcccaggattgggcactgcggcagccccggcacagggcggggcccacctgaagcag
TGTGACCTGCTGAAGCTGTCCCGGCGGCAGAAGCAGCTCTGCCGGAGGGAGCCCGGCCTG
GCTGAGACCCTGAGGGATGCTGCGCACCTCGGCCTGCTTGAGTGCCAGTTTCAGTTCCGG
CATGAGCGCTGGAACTGTAGCCTGGAGGGCAGGATGGGCCTGCTCAAGAGAG
gtggggaggagggctaggggacggggagggctgggggaagaagccttcagggaggaggag
gctgggagaggctgccctttcctttttcctggctcccgtgcccaggccacactgcccttc
ctgccctagcacggtcccaaatgagaagagtcacaagagttaatgaggggcagttgaagg

Exon  5 +      24700      24990   1   Internal    291    82        Good
ggcagttgacagggagacccacccggagctgtgtcctcaagccacattctcttgtcctgc
ccatcacagcgctgccaccaccgcctctggccctcagagggcggcaggcaacctctaagc
ttcctcctttcctctcttccccctttcctccctccctatgcccctgggtgcccgatccag
GCTTCAAAGAGACAGCTTTCCTGTACGCGGTGTCCTCTGCCGCCCTCACCCACACCCTGG
CCCGGGCCTGCAGCGCTGGGCGCATGGAGCGCTGCACCTGTGATGACTCTCCGGGGCTGG
AGAGCCGGCAGGCCTGGCAGTGGGGCGTGTGCGGTGACAACCTCAAGTACAGCACCAAGT
TTCTGAGCAACTTCCTGGGGTCCAAGAGAGGAAACAAGGACCTGCGGGCACGGGCAGACG
CCCACAATACCCACGTGGGCATCAAGGTGAGCATGTCCCTGGCTGCCCGCA
gtgccttcccaccagggtacacagctggggagcatggcttgaaggaggccagcaccccac
tccccaaaatacatgaagagccgtgaacttcataaaggcaggatgaacttcacgtcttca
accagcattcccttggcatctactctgggctgtgactgggtgccaggaacacagcggaag

Exon  6 +      25788      26317   1   Terminal    530    77        Good
tgaaccggggctgctgtgttcagtcactcagttggtgtgaactgggactgctgtgttcag
tcgcgtaagttgtctattccacaagaactccaggccaaggggaggagctggggctgagac
cctgggtctctttcccattctcctgcctctgccctgctggggttggtgctctgggggcag
GCTCTGGCTGCTGGGCCCAGGCCTCTGACCACGCCTCTGTTCTGCCTCCCCCACAGGCTG
TGAAGAGTGGCCTCAGGACCACGTGTAAGTGCCATGGCGTATCAGGCTCCTGTGCCGTGC
GCACCTGCTGGAAGCAGCTCTCCCCGTTCCGTGAGACGGGCCAGGTGCTGAAACTGCGCT
ATGACTCGGCTGTCAAGGTGTCCAGTGCCACCAATGAGGCCTTGGGCCGCCTAGAGCTGT
GGGCCCCTGCCAGGCAGGGCAGCCTCACCAAAGGCCTGGCCCCAAGGTCTGGGGACCTGG
TGTACATGGAGGACTCACCCAGCTTCTGCCGGCCCAGCAAGTACTCACCTGGCACAGCAG
GTAGGGTGTGCTCCCGGGAGGCCAGCTGCAGCAGCCTGTGCTGCGGGCGGGGCTATGACA
CCCAGAGCCGCCTGGTGGCCTTCTCCTGCCACTGCCAGGTGCAGTGGTGCTGCTACGTGG
AGTGCCAGCAATGTGTGCAGGAGGAGCTTGTGTACACCTGCAAGCACTAG
gcctactgcccagcaagccagtctggcactgccaggacctcctgtggcacccttcaagct
gcccagccggccctctgggcagactgtcatcacatgcatgcataaaccggcatgtgtgcc
aatgcacacgagtgtgccactcaccaccattccttggccagccttttgcctccctcgata

--------------------------------------------------------------------------------