--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (56622 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        930       1399   0   Internal    470    49    Marginal
tgacctgcccgagcggggcttctggaaacatccctgtgctttctaccctcgattcctcgc
gggcccacgtcccaacgggtcacggtccccgccagcaaaggagccacccgttcatgccca
cgccaagccctcgccatgtgaacgcccgggtcaaagcccccgcgccctaaccctggccag
CGGGGGACCGCGGCGGTAGCAGAGGGTCCGGCCCACCGCGTCCCCCCGAAGCCCCGCGGC
GTCCGGGGCGCGGGCTTTGCCCAAGTTTGCTGGGCGATGCCCTTCCCGGAGCCCGAGTTG
TGGGCCGGGCGGGAGGGGCGCGTGATTGACAGGCTGAACTACAGACTCATCTCTTACCTT
AGGCCGCGGGCGCTGATTGGCTGCTCGCTGACATCCTCAAACCCGGCTGCTCCGCGCTGG
GCTCGGGAGGGGGGCGGCTGCGGGTGGAGGTGCGCTTCTGACAAGCCCGAAAGTCATTTC
CAATCTCAAGTGGACTTTGTTCCAACTATTGGGGGCGTCGCTCCCCCTCTTCATGGTCGC
GGGCAAACTTCCTCCTCGGCGCCTCTTCTAATGGAGCCCCACCTGCTCGGGCTGCTCCTC
GGCCTCCTGCTCGGTGGCACCAGGGTCCTCGCTGGCTACCCAATTTGGTG
gtaagactcgcctcttgtctgcccgcggcccggtttctccgccgcgtccggggaaggtgg
gggcgccggctgggggtgggccgctgcagggctggggctcctctcctcgcctccctccag
ccccccacccgcccacccctcctggattttctgctggtgtcgccttcagaatccaactcc

Exon  2 +      22941      23064   0    Initial    124    57    Marginal
gagaagattctcctgcctatttcagtcagtttggttttgtggtcttattttcctcggtaa
ccaagctgagagtcctctgacttctgttgtaatcatcccgtgtaaactagttcagtccag
accaccctttctggagggcttgagtggaaggaatgaatgaatgcactcaggaattaatga
ATGAAGCAGTCAGCCAATCAGTCAGCCATCCAGCTGAGCCCCCTCTCCTATGCAGCAGCC
AGGAACCAGGGACTGATCAGGCACCGCTCATCTTGCACCAGGGGACACCCGGGCTGTCTG
GCTG
gtgaatcattctcccgtcttaggtcccctgtagttgcatttttaggatctgtcacccaat
gaggctgggagcccctgcggggcaggaaccaagttgcgcttgcctctctgtgtgccccga
gtgggacatacagatgggatctctcatccaactccttctgagaggggcaggagaacattg

Exon  3 +      24626      24647   0    Initial     22    56    Marginal
ggccacaccaggggagtgagacatggggcgccggtagaggggctgaatgcgctggtgtgg
ggtaggaggtttcggatgcacattccagagggtgtttatgggggagcagacaagcctggg
gattcattcctggtagggaacaattccctcagcacccgagggtgggaaatgagggccaaa
ATGGTGGCTCAGAGGGACACAG
gtgaggtaagcaggtaagaattcccaccaggtgtctcagaaatgtcctgggaagggcctg
gcatggtggctcacacctgtaatcccagtattttgggaggccgaggcgggcagatcacct
gtggtcaggagttcaagaccagcctggccaacatggtgaaaccccgtctctactaaaaat

Exon  4 +      27454      27522   2   Internal     69    77        Good
tggccactctgagtgcctcagtgaataggctccttactaccttacttagagcagagttga
ggaaattggtgaagttcttcactaccttattagccactctctacccaaataaatgtaccc
caccttatcttattcattatgggtaatcacctgtaaaagcgttctttatttcattcacag
CCTGAGTGTCCCCAAAAAGGTGCTCCATGACGTCATCCCCCCTCTGGAGGACACCTCCTC
CCACCCATG
gtgatttgagccttctcttaggccagggtgattcctgggggaaccttaactggggctaat
gtgcactgacattttgccttttgtgtcgaacacacatcccatttgcagagatttagaatt
ttttgactttaaatgttcgctatttctatgtatgtgtaagagagagttgttttcttttgt

Exon  5 +      45251      45377   0    Initial    127    53    Marginal
ttacaaagcgaggggcagaggaatggagtgaattgaccagtcacctggtgttgggtgtgg
gcagtgagatctgagatctcccttctgactctgtgctaaacttgttttgacacaaagcca
agctccagtctctcatgagaaaagaggtggagctctagaaacttctaggaaactggaaag
ATGGTCATGGAGGCCCTGGTAGACAAAGGACTTGGTGCAAGCCAGCAATTCCTTGGGGAG
ATACTGGGAGGCTCTGGGCTGGGCTGGCACCATCGCAGGGAAGAGGCTGAGGGCATTGCC
AAGGGTA
gtgtgtgtgtgtgcgcgcgcgcgcgtgtcccatgagtcactggaagtgtccatgtggccc
cagtatcctggactgccttggaaattgcccagcctgatctcttcaatgcccatcagggaa
gctggacccagaacctggaaaggactggatctgggccccaaataccatctttctagtcca

Exon  6 +      45844      46085   2   Internal    242   100   Excellent
tcagagctctgcgctttgaggggcggcatgctcccgaggtcaaaggtagcacattcaggt
gccagggcacaggccctctgcctctccacctaccccggagggttcacaaagcggccatgg
tgcccaggatgggctctgtgctttgtgcccacagtgttactaccctctgtctgcctgcag
GTCCCTGGCCCTGGGCCAGCAGTACACATCTCTGGGCTCACAGCCCCTGCTCTGCGGCTC
CATCCCAGGCCTGGTCCCCAAGCAACTGCGCTTCTGCCGCAATTACATCGAGATCATGCC
CAGCGTGGCCGAGGGCGTGAAGCTGGGCATCCAGGAGTGCCAGCACCAGTTCCGGGGCCG
CCGCTGGAACTGCACCACCATAGATGACAGCCTGGCCATCTTTGGGCCCGTCCTCGACAA
AG
gtactgccttggggctgagggggggggaggggctgggtggggggagggatcaggactgta
tgcccttccaccccagtcagggtgcctcttctctgaagccagggtccctctgggagggtg
ataaatttggttgcatgactgccacaccttcccaggcgctgctgggggctgggccgcctt

Exon  7 +      49700      49965   1   Internal    266    95   Excellent
ccaactgggtctaaaccagccaaagagggtggggaagctgcctccctcttgcctcagggc
tggtgagctcttcaactcttcctggcctcgttcccctcacgtcctggcctgggaggtgga
ggcagggcaggcgctcccaggccgggtcctgagtgctgcctccccacgacctccccgcag
CCACCCGCGAGTCGGCCTTCGTTCACGCCATCGCCTCGGCCGGCGTGGCCTTCGCCGTCA
CCCGCTCCTGCGCCGAGGGCACCTCCACCATTTGCGGCTGTGACTCGCATCATAAGGGGC
CGCCTGGCGAAGGCTGGAAGTGGGGCGGCTGCAGCGAGGACGCTGACTTCGGCGTGTTAG
TGTCCAGGGAGTTCGCGGATGCGCGCGAGAACAGGCCGGACGCGCGCTCGGCCATGAACA
AGCACAACAACGAGGCGGGCCGCACG
gtgagcccggctaccctccccaaacccttcagggagcagccccccgcttcccctccggag
ctgccctggcccccacctcaccccttccggcagccctgtgggtcgcgggctccttttccc
cttggccaggcttggcctcctccccaccccacagccacttcgtctgtccaccctccttcc

Exon  8 +      50948      51376   0   Internal    429    97   Excellent
ggggagggaaacatggtcactattctttaggtcttgcctcagtccccatcagttctcttc
ctgtcacagaggagtagagaaggctggagggaagggggtgggcagtggcagagagggaag
gcctggatgtgccccctcgtggggtcggtctgttggccagctgccacttctctcccccag
ACTATCCTGGACCACATGCACCTCAAATGCAAGTGCCACGGGCTGTCGGGCAGCTGTGAG
GTGAAGACCTGCTGGTGGGCGCAGCCTGACTTCCGTGCCATCGGTGACTTCCTCAAGGAC
AAGTATGACAGCGCCTCGGAGATGGTAGTAGAGAAGCACCGTGAGTCCCGAGGCTGGGTG
GAGACCCTCCGGGCCAAGTACTCGCTCTTCAAGCCACCCACGGAGAGGGACCTGGTCTAC
TACGAGAACTCCCCCAACTTTTGTGAGCCCAACCCAGAGACGGGTTCCTTTGGCACAAGG
GACCGGACTTGCAATGTCACCTCCCACGGCATCGATGGCTGCGATCTGCTCTGCTGTGGC
CGGGGCCACAACACGAGGACGGAGAAGCGGAAGGAAAAATGCCACTGCATCTTCCACTGG
TGCTGCTAC
gtcagctgccaggagtgtattcgcatctacgacgtgcacacctgcaagtagggcaccagg
tagggctccgggaagcaggggggaggctgggagcctgggcgcagggaatggggttgtttg
cccatctcgtcttcttgacgacccccttctgtttctaagctatccaagacacacaagttc

Exon  9 +      52251      52347   0    Initial     97    53    Marginal
gtcattcttgagcattatttggagatggggggctggaagctgggagacctgacgtctggt
cctaactttgtcagtaacttcctgttctttcacttttctgggcctcagctttcttactat
aaagtggtgatggtggtgaagggcagggggcagtttaaatacctcaagcagcgagccaaa
ATGTCTCCTCTACCCCTGAGGCAGAGTCAGTGTGCATCCACCTTGAACTTAGAGGGCAAG
TTCCTGCACAAGCATAAATCGTACCAACCTCAGGGAG
gtgggtggggggaagcggcatataagcccatatcctgacagatctgaagcttgggtggag
tggggagcactctcaccgagtttatggatgatgacggggagcaggagggattcaagttca
gagtggctgggatgagtaatcgagggatcaaaggcgggtggattttgttcccaagcttcc

--------------------------------------------------------------------------------