--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (49037 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (23 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1542       1731   2   Internal    190    67    Marginal
atgaggaactgggtgcacacatgagtggggcagccgggcctggccagagaagcaacacac
acgtgcacagacatgtttatccacatacacatgtgcacgcatgtgcacaaacacattgca
ggcaggcatgttgacgcctcaggcagcggaggaccctgactctgggccctgctgacccag
GCAAGGCCCCATTGTGATGCGTGCCATGACCTCAGAATGTCACTGGTGCTTAGCACCTAT
CCGCTCTCCAGACTGCGTCTGTGTTCTACGGCAGTTACACACACGCAGTGGTATTCACAA
GCGGTTTTGTGGACTCAAAGGTTTTCTCCCTGAGAGGCATAACCCAGGCCAGCTGATTCA
TCAGAATCAG
gtgagtgtgacctgctctcttccctccaggctgacttggggacagtggctatggtatggg
cggtgttggcctctgggcagctacagaggagggtcatccctgagcactcaccgggcgccc
gttctacactgcccatgtagacgattttctctttcgtcttcatggtggcttcgtagagtg

Exon  2 +       1872       1942   1   Internal     71    51    Marginal
tgagaggcataacccaggccagctgattcatcagaatcaggtgagtgtgacctgctctct
tccctccaggctgacttggggacagtggctatggtatgggcggtgttggcctctgggcag
ctacagaggagggtcatccctgagcactcaccgggcgcccgttctacactgcccatgtag
ACGATTTTCTCTTTCGTCTTCATGGTGGCTTCGTAGAGTGGGTGCTGTTCCCGAATGTAC
CCATTCGACAG
gtgagccgtctggggtcagagaggcagtaactggcctgggaatccagacaagaccctggg
ttttgctctcagccctgctgtgtgccatgctagacttcaggcctcaaccctgagacctcc
ctgctctagatcccaaatctgcccagatttccgatcccaatggggcagagcctggccctg

Exon  3 +       3176       3287   2   Internal    112    82        Good
cttcagactgcagagacccatggaggtgtgggccatggggtttggcccctttttaccgga
gtgcagtggtggaatgaaggttatacaaccagccagcatctgggagcccggtgggagcgg
ttcaggtgttctccgaagctgtcgggtacagtgtaacctttagacaattttgtctcacag
GATGGACATGGTAGAGAATGCAGATAGTTTGCAGGCACAGGAGCGGAAGGACATACTTAT
GAAGTATGACAAGGTACAGTTCGGTCTGCTCCTTGGAGGGAGGCCTCTTCCA
gtgcgccctggtcaaagggtcctgggttccctaggagcacagggcagggacgggtggcca
atacccccaggcccttgcaccctttaccttggacccctcaccaaggctccctctgggtta
cagggacaccgagctgggctgccagaggacaaggggcctgagcccgttggaatcaacagc

Exon  4 +       3411       3493   0   Internal     83    73        Good
cttatgaagtatgacaaggtacagttcggtctgctccttggagggaggcctcttccagtg
cgccctggtcaaagggtcctgggttccctaggagcacagggcagggacgggtggccaata
cccccaggcccttgcaccctttaccttggacccctcaccaaggctccctctgggttacag
GGACACCGAGCTGGGCTGCCAGAGGACAAGGGGCCTGAGCCCGTTGGAATCAACAGCAGC
ATTGATCGTTTTGGCATTTTGCA
gtgagtcatcctctatgctcccctcacccctaaagcagctgtctcagctcagggatgggt
ttgcttttagaaaggcctttctgatgcaggacatgtctcgctaggtcgggccaacctctt
ttccagggtcagaactcctccctggctcccctgcaggtccagcccgaggttgttgttagg

Exon  5 +       3650       3761   0   Internal    112    53    Marginal
cattgatcgttttggcattttgcagtgagtcatcctctatgctcccctcacccctaaagc
agctgtctcagctcagggatgggtttgcttttagaaaggcctttctgatgcaggacatgt
ctcgctaggtcgggccaacctcttttccagggtcagaactcctccctggctcccctgcag
GTCCAGCCCGAGGTTGTTGTTAGGCCAGAGGTGGAAGGCCCAACTAGGGAGCTGGTGGGA
ATGGAGACTGGGCTAGGCCAGGCCCCTGGGCTCTCAGCAGTTCTGTCGGCAA
gtgagcacaagaggagcggggcagcctgaggttctggtcctgtctaccaggagacaaccc
cagtgagatccaagggttgtggccacagggtgaggagacacctggcccagtctcagggct
gttgtccagcaggtctctcagagcccaccggcccctgtcctcctccatttccctagagct

Exon  6 +       5620       5750   1   Internal    131    67    Marginal
tcctggcttggggggtggctgcgcgcttgtgtcaggaccccacctagaggctgggaccta
agactggtgtgtctgtggcctgaggatggcatgtcccggggtcccaaagccagcccattg
gtgctcatttgctcaaaggctctcagcccttagggtctgcccttccctggctccttccag
TTGGGTCCCACCAGGGCTCCAGAGCCCAAGACTCAGCATCCATGGGCGGCTCTGGGAAGC
CTGGCAGCTCCACTAACTCCAACATGCCTCATTTGACAGAAAATTCGGCGGGAGATGACA
CGAACGAGCAA
gtggatggaaatgctgggagaatgggagacatataagcacagtagcaaagtaatgtgtgg
agggagaggcccctggaagcactctctgcagaaacaggggacaggcacccatggctgtgg
cctggcaccgtcagcctctcagagggcgggtggcacactgtcctcgcccagaggactgca

Exon  7 +       6252       6359   0   Internal    108    83        Good
tttagactctgagtgtccatccactctttcagtcctgggaagggagaccctgtcccagct
tgatctcgcctctactgaggaatcatggggccaaaactgacaatttccagaatccccagg
ctctggtcctcactggggtcaccccatggcctgtgacaccagattcttttctgcccacag
CTCATAGATCGAGTGTACAAGGGAATTCCCATGAACATCCGGGGCCCGGTGTGGTCAGTC
CTCCTGAACATTCAGGAAATCAAGTTGAAAAACCCCGGAAGATACCAG
gtatgctcagccagagcacaacaaacaggacaggccgtgtcaggggcccaggtctccagc
tggagggaacgtcaagcccaccctggggtgggggggtgggaggggatggttagatgcaca
tcctgggcatggacggtgacacagtcaccacagacaaactcggctgtggtgaccctccct

Exon  8 +       6696       6805   0   Internal    110   100   Excellent
aactcggctgtggtgaccctccctggcctcagtagcaagccaaaaagcagctttctgcag
aaggaaaccttccttctttccttccttcccgaagtgctgactgtgggctgactgccattt
ggggcagggagtcttccatctgttctgaggctgcttcctcctcttggccctgccctacag
ATCATGAAGGAGAGGGGCAAGAGGTCATCTGAACACATCCACCACATCGACCTGGACGTG
AGGACGACTCTCCGGAACCATGTCTTCTTTAGGGATCGATATGGAGCCAA
gtaagcctacgggagccacacagtcccagcagagatggggtgaacgagagggatggggac
ttccccggagcagaagccagggtcacccaggagggatgacagagctgccaagagctctcc
tggcccagggagcagccggcaccatgaaccgagcacctccctggttccaagccctgggcc

Exon  9 +       8043       8091   2   Internal     49   100   Excellent
gcatgtcacagatgtggattttactgaaacatttcttcaacagtctcaggccctgaagag
ctcactgcttatctggtgaatcatctgaacctgaaatgggatttgttaggatttgtagac
aaagtgaaactaacagcatctgcacaaaccaaaccatagccccctttctgtgtttcctag
GCAGAGGGAACTATTCTACATCCTCCTGGCCTATTCGGAGTATAACCCG
gtgagtattcccggcagtgaggttcccaggctgtatttccatattcacaggagtgggtgt
ctggtgggggtgtcgttgcttcttttaaagttggtatttgtgactcaccaggatatagga
ggtaggattctaggtcaccgctggcataaacctccaagcaagggggtggtctcaaggggt

Exon 10 +       8617       8737   0   Internal    121   100   Excellent
aggtgctgaagtgcctgatggactttgctcttgtcatgaaatgaatttgcatcctgagga
agcctcttcttcagaggaagcctccccagtcacctctgccctctccaatgacatgagtcc
tcccaggtgacctcagccctcccaggtgatgtccttccatggtgactctggctcttgcag
GAGGTGGGCTACTGCAGGGACCTGAGCCACATCACCGCCTTGTTCCTCCTTTATCTGCCT
GAGGAGGACGCATTCTGGGCACTGGTGCAGCTGCTGGCCAGTGAGAGGCACTCCCTGCCA
G
gtaggtgaacagctgcccgtggggcctcacgcagccagacccgggaaagccactgtggcc
aggtgatctcggctttcagccaaggcacactccttgtgttgccagcttgttgggagcatt
taggacgtctctgctgagggtcccacaggagtccgcagctgacccccacaacccaagtca

Exon 11 +      10930      11082   1   Internal    153    89        Good
gtggtgagcacttccctgtccagatcaccccccagccacagtctcctgtgtacatctgga
tgcctggggtggccacaaaaggattcggcaccgcccagtgggagactgaagtggccacag
ggtatgagctgtgaccattcccagggaactctcctggcctgatatccaccctgtccctag
AGCGCCTCATGAAGACATCCAGGTGTGGCCTGTGGGCACGTCTGCGGAACCAATTCTTCG
ATACCTGGGCCATGAACGATGACACCGTGCTCAAGCATCTTAGGGCCTCTACGAAGAAAC
TAACAAGGAAGCAAGGGGACCTGCCACCCCCAG
gtgggctccagtgccatgtcccctcccatgtcagcctctggggcagtcaatagtgggcgg
gtgccccggaccagcaaccctactacctgggccttcctcttcaccttttcttcctcctct
tcctcctggactctaagaaagtacaggaggcccaccggtcctcagggcaggcactcagtg

Exon 12 +      14234      14308   1   Internal     75    63    Marginal
cctaatgatgcatttctcagaatgtaacctcatcattaagcaatgcatgtactaaaatta
gctagattttaaaacttccgatttaggaataagatgtctttaaaaaaaaaaaacagaagc
aatcaagtgggtgtaaattagacagataagaaattaacacattcctatctgtccttccag
TTCACAACAAAGATATGAGTTGGCCTGAGGAGATGTCTTTTACAGCAAATAGTAGTAAAA
TAGATAGACAAAAGG
gtaagtctccagtattattttttaaagagattattttaaatgtattttttttcttctttc
aactattaaagtgctaacaacttttggttttctagttcaaaagtaattagggcccttctt
tttcttttttcctgaagcagcatttgatgttggcaaacccaccatcaaattattttctaa

Exon 13 +      17499      17672   0   Internal    174   100   Excellent
tcatttgacattaagattcaaaagatttcatgattatccaaaatacatttgttgaaatgg
aggcagactaagtactatactatttattttcttacaatggctctgattggattataggac
atgttcattccaaattttatgggtaggaaataatgactgtgacttctcttatatttatag
CGGACCATAGCAAAATATGCTCCCAAGTTTGATGGGTTTCAGCAACAAGACTCCCAAGAA
CTTCTGGCTTTTCTCTTGGATGGTCTTCATGAAGATCTCAACCGAGTCCATGAAAAGCCA
TATGTGGAACTGAAGGACAGTGATGGCCGACCAGACTGGGAAGTAGCTGCAGAG
gtttgtcagttttgagtttctaatgtaagcaatagacaaaatgttctgaccacaaataca
tgtagcacaacttaaatgcaaactaaactattctgagatcagaattttactgcaaaaatt
aaggaatttctatttctatgcttaattgttatgtgataatgccaaaacaaaaataccttt

Exon 14 +      18214      18388   0   Internal    175    54    Marginal
tgataagaacaaatgaaaaataggattttccatctcaatttaatattttatgttaaatga
agagtaaggattatattctttacttttaaatccaatatatttaaccagtttctgtgaatt
tatatagaaatgcctctcttttggattttgagagaaaattctcatcttttttattgctag
GCCTGGGACAACCATCTAAGAAGAAATAGATCAATTATTGTGGATTTGTTCCATGGGCAG
CTAAGATCTCAAGTCAAATGCAAGACATGTGGGCATATAAGTGTCCGATTTGACCCTTTC
AATTTTTTGTCTTTGCCACTACCAATGGACAGTTACATGGACTTAGAAATAACAG
gtaggtcacaaagttctgaaaaattacttgattccattaaatttactttatttaaatagc
ctgaatttgtaagcatagttatttgtttacaaataaagactggtagtcagcatattataa
tcgagcaacctaattttaggcatgacttgaggtttgaaagatgtagattggggcatgttt

Exon 15 +      18751      19013   1   Terminal    263    73        Good
ttggtttcaaatatgccagcaactctctttaaaaccctgcaaagccactcacacttttat
gtcagatgaacaccaaaaaaatactgatttcacttaatattatccctaagtaccatctgt
tttagtgtttacccataaaataaaaattctaggctgaaatatttgctattatatttacag
GTCAGATATATCTGTACACAGCATTTAAGGCTTTCAATGAAACCTGCATTTTACTGATAA
AAGATCTTTTCTCTTTACTAGTGATTAAGTTAGATGGTACTACCCCTGTACGGTATGGAC
TAAGACTGAATATGGATGAAAAGTACACAGGTTTAAAAAAACAGCTGAGGGATCTCTGTG
GACTTAATTCAGAACAAATCCTACTAGCAGAAGTACATGATTCCAACATAAAGGTAATGT
TAACTACTCTAAGAAACTTTTGA
ttctatccttcaaagatgacatttttctcaattatgatgatcagttgttaggttatgtga
ccaagagagatactaaaacataacgaaaactgaacaacaacaaaaaatgccaagttttcc
aacccagaaacttaaaagagttttctaccagaataaagggataatactgatggtggtatt

Exon 16 +      21316      21576   0    Initial    261    72        Good
aatagtttccagcagttactctttccttttcatttggtcaaaagtgtgagttagggaagt
aaaactggaaattaaaatcttccaataaatctagaattatttatactatgatttctccct
gccctgtgttaagagactacactgtctctcgtcctcaggatacttgagaaaagagcaaag
ATGAAAATACCACAAGCTTATGATGCTGTACTTATCTTTGAATTTGTAGATTTCTCCTCT
TCACCATCTACAAATGGAATGTTCACCCTAACTACCAATGGGGACCTACCCAAACCAATA
TTCATCCCCAATGGAATGCCAAACACTGTTGTGCCATGTGGAACTGAGAAGAACTTCACA
AATGGAATGGTTAATGGTCACATGCCATCTCTTCCTGACAGCCCCTTTACAGGTTACATC
ATTGCAGTCCACCGAAAAATG
gttagttaaatgttaggcaactcactgccagtcttgctagtgtcatttgtgaaatagcca
ttttctgtctttgcaacatcattgaatgcattttcttctcttttttctttaatttttaaa
aatttaatacttttacaaattttatttttttacttttctatcctgtcctcaaaacctgtt

Exon 17 +      24443      24549   0   Internal    107    49    Marginal
tgtgtgtgtgtggtgtgtgtgagttgataagctgattctcatatgtggaaatacaaagca
cccagaatagccaagatactcttgaagaagaataaggtatgaggatatcatcaagattgg
atatcatccagatatcaagatttatttcacaaagatatgatacttaaaataatgtcacag
TGGTACAAGAAAAGACAAATAGACCACTGGGATAGAATAGAGAGCCCAGAAACCAGTTCA
CAAATGTATGAACACCTGATTTATAACAAAGAGAACATTGCAGGGTG
gtgagagaaagttttctcagcaagtggtgctgggacaattagatatccatatgaaacttg
gcacctacctttcgccacaatttcaggtggtctatagagctaaatttgaaagcaaaacaa
tgaaacagcccttggaagataataatggtgaattcattcctgacattacgcatataaaga

Exon 18 +      35693      35813   2   Internal    121    94   Excellent
atgataataattattaataagtatccttacatttatcagagtctgaagttagaagcccat
gacaaattgtgaggcccaagaggaaagcagaaaagtaggaagggagaatattttttatta
agaaaatttaaattccttcataattatttcttcctctgtggatctttcccccctttttag
ATTTTGCAGAGGCTGTAAAATTGATTGTGGGGAAGACAGAGCTTTCATTGGAAATGCCTA
TATTGCTGTGGATTGGCACCCCACAGCCCTTCACCTTCGCTATCAAACATCCCAGGAAAG
G
gtaagaatttagggccaccgtaaaatggtggtttttatatgggaaatttcccccagtgta
actattatgccatttctgtttgacaatttaaaaacaaccagaaaaaccttcattggcatc
ctctatggcacctaatatattgacatgtttgcttgagctttttcattttccagcttctgg

Exon 19 +      40741      40932   0   Internal    192   100   Excellent
cctcggcctcctaaagtgctaggattacaggcctgagccatcatacccagccagttgtat
tttctttttccttataaagagtaaaataagggtgagtgaccgagcggttgatgcatagct
agatcaccagtttaaatgccttcccacacacccctttcctcctgttccctctacctacag
GTTGTAGATAAGCATGAGAGTGTGGAGCAGAGTCGGCGAGCGCAAGCCGAGCCCATCAAC
CTGGACAGCTGTCTCCGTGCTTTCACCAGTGAGGAAGAGCTAGGGGAAAGTGAGATGTAC
TACTGTTCCAAGTGTAAGACCCACTGCTTAGCAACAAAGAAGCTGGATCTCTGGAGGCTT
CCACCCTTCCTG
gtatgttacggtcctgcctctgagagagcaggaatctagcataaaagaaagaagacatga
acaaacaggaggttttgttatttttgagaataagacttttcctgcagcagtgtttaaaac
acattctgtacaaggtttttatgttgaatacagagatgaatctttctacaaatatttggt

Exon 20 +      41726      41864   0   Internal    139    99   Excellent
atgcgatgttttctacctttacttctccagattattcaccttaagcgatttcaatttgta
aatgatcagtggataaaatcacagaaaattgtcagatttcttcgggaaagttttgatccg
agtgcttttttggtaccacgagacccggccctctgccagcataaaccactcacaccccag
GGGGATGAGCTCTCCAAGCCCAGGATTCTGGCAAGAGAGGTGAAGAAAGTGGATGCGCAG
AGTTCGGCTGGAAAAGAGGACATGCTCCTAAGCAAAAGCCCATCCTCACTCAGCGCTAAC
ATCAGCAGCAGCCCAAAAG
gtgaggcctgggggccttatgcagttgctttcttgggactcctgtaggctacatatgttt
ctctgtcttctgttctggaacatcaggttggttgggtggaaggaacctatctggaatcag
acctatctgtatttgagctatgtaagttgtagcaagagattcagcctccctgaatctatt

Exon 21 +      43288      43724   1   Internal    437    87        Good
gaagaagacaaaaatgtaacttactggctacacaataggaaccaaagggtagccagtcat
gactcccctgtctttacctttgtgtgtacagttgcaaagctaacctcggagttagcattt
ggggctggcttactttctggcatttggatttgtgaatcttttcttctgtcctgttcacag
GTTCTCCTTCTTCATCAAGAAAAAGTGGAACCAGCTGTCCCTCCAGCAAAAACAGCAGCC
CTAATAGCAGCCCACGGACTTTGGGGAGGAGCAAAGGGAGGCTCCGGCTGCCCCAGATTG
GCAGCAAAAATAAGCCGTCAAGTAGTAAGAAGAACTTGGATGCCAGCAAAGAGAATGGGG
CTGGGCAGATCTGTGAGCTGGCTGACGCCTTGAGCCGAGGGCATATGCGGGGGGGCAGCC
AACCAGAGCTGGTCACTCCTCAGGACCATGAGGTAGCTTTGGCCAATGGATTCCTTTATG
AGCATGAAGCATGTGGCAATGGCTGTGGCGATGGCTACAGCAATGGTCAGCTTGGAAACC
ACAGTGAAGAAGACAGCACTGATGACCAAAGAGAAGACACTCATATTAAGCCTATTTATA
ATCTATATGCAATTTCA
gtaagtggtttattatacggttttcagagagtggtctgtgttttgttcacttgtcttcat
gtattcatcagcaagtatttttcaggtcctgctaatttcctagcattgagcttagtgata
gacaaagttaacattgaaatctgggctcacagatgtggtgtggtggctcacacctgtaat

Exon 22 +      44396      44509   0   Terminal    114    49    Marginal
cttatgacttttgtattttgctttttgcttattttggttttagagaaagagggttctaaa
atattttctcacctattgatcatttacatgatcagtgttctcctgctcagatcttagtgc
tataccctggccatagtacagttaactactaacatacctccactctcttatctcttacag
TGCCATTCAGGAATTCTGAGTGGGGGCCATTACATCACTTATGCCAAAAACCCAAACTGC
AAGTGGTACTGTTATAATGACAGCAGCTGTGAGGTAAACATTCTCAATCTTTGA
atgaaagttagaatatcaacagaactggggaacatttgttgaaataatggactatctctt
gaataggaaatagatatttctgttagaattaatatatagatgctgtcagtattaaaggaa
caaaagtgatatgcagagcagggaatgaaaacatgagtagtgaggaaaaataaagagtta

Exon 23 +      45614      45787   0   Terminal    174   100   Excellent
agcaaacattggaaataatggggctcattttaaaggggcaggtgtgagacagccaaacta
gtgagcttattggaagcaatcaggttagtaattacagagggttggtcttccctttcctgg
caaggatttagagtcataatagtgatggctttttgttaaaggtttttcttgccctttcag
GAACTTCACCCTGATGAAATTGACACCGACTCTGCCTACATTCTTTTCTATGAGCAGCAG
GGGATAGACTACGCACAATTTCTGCCAAAGATTGATGGCAAAAAGATGGCAGACACAAGC
AGTACGGATGAAGACTCTGAGTCTGATTACGAAAAGTACTCTATGTTACAGTAA
agctaccactctggctgctagacagcttggtggcgagggagatgactccttgtagctgat
acttggcaaaagtgtcactgaaagacaagctaaatgtagttattttatcctgttagaaca
aaaattctaattaaaatagttaacttgaagagtagaaacaattgtattttgaagtctcat

--------------------------------------------------------------------------------