--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (21682 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1899       2158   1   Terminal    260    82        Good
gctgcatatggcttcagacaagttgtttaaactttccgagactcccttgtttcatctgta
aaatggggatagctgtacatataaagtacttgtgagtgttaagcgaaatagtgtcataag
cgtaccccgtataaagtatttcttgaacaaatatttatcgggtatttatttttatgccag
GCACCAAAGATGGATCCAACGGTGGACAAATGTACAAGCCCACTCTTAAATTTTGTATTC
TAGCAAAAGAGAGCAATAATTTTAAAGTATTAACAATGAAGTATAACGTACAGGGAGCTT
ATGTTAGTTGTCAGGGTCCCCTGCAGCGAGGCCTGCTGGATGTTGACAGCTCCCTTAATG
TGAGCAGAAAGGAAATCTACACCAGAGTCAAAGGTTTCTGGCTGTTCTTTAAGAGGGAAA
GACTCAGGTTGGACCATTGA
gaaaatgagctgtttctttccacaccaggactcattccttatgctccagggaatttcctt
aaaattaataatagaagcgaaaaatcagatctattccacatgtttggttgcaaatacctc
caatagtcatagaagtttatttgccttctttccaaagatgaatttttgtctttttgtacc

Exon  2 +       5006       5121   0    Initial    116    77        Good
aaacttgattttttgagattaaaatatttcaaaaaccaagtgtccccttataatttatta
tgcataaaaaggaattttttttgcctttctttagttatatttttgtgtcattatagtttc
acattaacacacaaaatatagaagactagggattaaaacatccaacagaatggatactaa
ATGAATTATTCTTCTTCCTTTTTTCTTTCCATTACTTCTACCACCACCACCACCATCACC
ACCACTACCAACACTATCACCACTATCACCTCTGCCACCCAAATGTACCGCTGCAA
gtaatatacacttctttcatgcctttgatacttcaactgtgttttgcctacttaaatatg
ctttatttgcgtcttttctaactgtatagactagaaattgatcagccgttctcttttctc
ctaaagagtatcaaatgtaatatctgcttaaatgtctttcttttgggtactaaggatatg

Exon  3 +      11477      11557   0   Internal     81    98   Excellent
atgtgcttaaagtcattttcttttgaacatttctgaatttgcagtgatagctattttcag
tgaagaaaatatttggacgaatagaagaaaggcgcattagaattttttaagggactctct
tttcagtttgccagtgaactccttacagttgaataatgaatgtatttaactctttcgtag
GCATCCTCTGGTATCACGATTCCAAAACCCCCAAAGCCACCAGATAAGCCGCTGATGCCC
TACATGAGGTACAGCAGAAAG
gtaggtgcttaggacctggtaaggagtgaggacactgtctttgctgcttctttgcttaac
atccaactttagatcggcttagccagcttttctgtgcatattcagaggaaaggtccaaaa
aaatacggtttttaaagcaattagttctgatttcaaaattccagaactaaaatccaacaa

Exon  4 +      12947      13118   0   Internal    172    83        Good
ctctgtctacctgagtcaagtcagtttctcaaggcctcagatttcttgcctgtaaaaagg
agataattatcccaacaccctgtttacatcatatcttttgatattcaagtgagataacat
aggtctgcattataacctgcaaaatgttaattataaaaccaaaaaacatttgaatttcag
ATAGAGTACAATGAATCTATGAAGGCCTATCATAATTCCCCCGCGTACCTTGCTTACATA
AATGCAAAAAGTCGTGCAGAAGCTGCTTTAGAGGAAGAAAGTCGACAGAGACAATCTCGC
ATGGAGAAAGGAGAACCGTACATGAGCATTCAGCCTGCTGAAGATCCAGATG
gtaaaagaaaaaaagtggggttttgtttatgctttctctgtgagttaagatatgagaaat
ctcttaagtataagtttttatttcttatcctaaatggaaaagaaagtataatttaagtat
cgtcttagtattttggttatattgagtaagatttgtatgtgaatttcccacaagaaaaag

Exon  5 +      14125      14265   0    Initial    141    45    Marginal
atatcaatgagggaggaagcaataatagtacctgaagacaagaataagttgataaaagtg
gggaaaaacagaagtcatttttaaaaataatgtactggaatattgtcaaatgttctcata
aatacagacagtggaatgtaatactatagagaatagaatatggaatagaaacagtattga
ATGTTAAGCAGAATCAGCAGTGCTAAAGACACACTAGCATCCTCACACTTTAATTACTCA
AATGGGGTGATTAATGCAAGAGAAACATACAGAACTAAAAATCAGAAGACAATCCAGTCT
ACAGATATTGGGAGGATGGAG
gtcagtacaagaggaaacaaaggctagcaacgtaagtagaaaataactaaagctttcatt
aacaccatgaacactgagaaggactaaagagattcactcagaaacagtctgaaacttggg
cctatgatgtttttaactttcagattgggtcttaaagttgctagtaaattcaggtagcaa

Exon  6 +      16682      16830   1   Internal    149    82        Good
acattacgtcctctgtatggtttttatcaagtaactgccccagtgctcccatgacgctgg
gcaggtccacttgttaggccagtgagggccatagttcgttggtaattaagtgttaacatt
gttacactcctttttatggttactggtgacctgatttccagaacaatttgttcactccag
ATTATGATGATGGCTTTTCAATGAAGCATACAGCCACCGCCCGTTTCCAGAGAAACCACC
GCCTCATCAGTGAAATTCTTAGTGAGAGTGTGGTGCCAGACGTTCGGTCAGTTGTCACAA
CAGCTAGAATGCAGGTCCTCAAACGGCAG
gtccagtccttaatggttcatcaggtaaagtcataaaacattcatttcaataagatgtgc
ctataccacaaatcccaggtgatatgattcctacaccatgcctaaatctacctgttaaat
atgtcaatctaacctgttcctgatttggagaagaggtttaaggaagtggacctttcccag

Exon  7 +      17356      17457   0   Internal    102    84        Good
tctttaacatttacctattgatcataatcatttctttgtgctgcattttgtattttttaa
atcttagctagactcatgtgataaatgatctaaagttcaaaacattatttggtacactgt
ttgaaagtatggaccattaaaaaatgagacacaattatgaagcctgatcctgtcttgcag
CGAAAACTAGAAGCTGAACTTCTTCAAATAGAGGAACGACACCAGGAGAAGAAGAGGAAA
TTCCTGGAAAGCACAGATTCATTTAACAATGAACTTAAAAGG
gtatctgtttaatatgttaactatacttttatcactatacctgttactttatttttcctc
attcttttttccaaaatagtgtttttattgaatgttgttcactttgaaacagggctaact
ttattataaacctgtaggatcctttttttataagattgttcccattctctggcaaaattg

Exon  8 +      18125      18412   0   Terminal    288   100   Excellent
agacccaagagtttcagagaagacctagaaccacatttttttggcacacacacacacaca
tacaggtgtatagatatatatatatagtttataggcaagaaaaccaacttttgaaagaat
atatctggctcaaaaattataaggaaaaaacattacggagttctgtttttttctgattag
TTGTGCGGTCTGAAAGTAGAAGTGGATATGGAGAAAATTGCAGCTGAGATTGCACAGGCA
GAGGAACAGGCCCGCAAAAGGCAGGAGGAAAGGGAGAAGGAGGCCGCAGAGCAAGCTGAG
CGCAGTCAGAGCAGCATCGTTCCTGAGGAAGAACAAGCAGCTAACAAAGGCGAGGAGAAG
AAAGACGACGAGAACATTCCGATGGAGACAGGTAACCCACTAGCAACAAACGCAGAGGCA
GTGCCAAGACTTTGTACGGCTGTCTTTAATTTAGGTTTTTCTTTCTAA
gtgcaagtattctggtacctgccactgagggtgattcccagtactaaatttgacatgata
ttgacattcagtattttaacctttaaatgcttacattatttatcaagatgtggttattac
cgttaagattaattgtctttggtgtcctaggacagcattctgcaaagtaatacctgtaag

--------------------------------------------------------------------------------