--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5579 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1444       1535   0   Internal     92   100   Excellent
cgtcacacccgccagggatgggccctgagacctgttctccccacccaggtgcaggagcgg
gacagggcactcagctcatgcagtcttcccttctctcctctggccctgtagcagggcctc
tccctctgtctgtctctgacatgtccctactcagctttgtttgttttctctttctgatag
AGTGCCCACGACCCTCCGGCTGTCCACCTCAGCAATGGCCCAGGACAAGAGCCTATCGCT
GTCATGACCTTTGACCTCACCAAGATCACAAA
gtatggggttggcctagcccttgacccagtcccctggttctgccctctctccatcagctc
ttctcttttccctgtcttcctttccttatctgtgaacaccatctcccccaaacccacact
ggttctcaaaggacacatgacatacacaatctttccttctgtgtccttccagaacctcct

Exon  2 +       1708       1897   2   Internal    190   100   Excellent
atcacaaagtatggggttggcctagcccttgacccagtcccctggttctgccctctctcc
atcagctcttctcttttccctgtcttcctttccttatctgtgaacaccatctcccccaaa
cccacactggttctcaaaggacacatgacatacacaatctttccttctgtgtccttccag
AACCTCCTCCTCCTTTGAGGTTCGAACCTGGGACCCAGAGGGAGTGATTTTTTATGGGGA
TACCAACCCTAAGGATGACTGGTTTATGCTGGGACTTCGAGACGGCAGGCCTGAGATCCA
ACTGCACAATCACTGGGCCCAGCTTACGGTGGGTGCTGGACCACGGCTGGATGATGGGAG
ATGGCACCAG
gtaagctagctctggtcctcaggggagggatgtctggagctggtctgaggaaagggaaca
aaaccaagttattgggcatccctctaccactgtcatctcgtttaatccacacgaaccccc
acaaagtagctattcttggccccatcttttctgatgggaattctaaggctcagtcagtat

Exon  3 +       2228       2389   0   Internal    162    99   Excellent
ctgatgggaattctaaggctcagtcagtatataagtgacaagagctgagtgacccaaggc
caaggatgctagctgcttctttaaggcatgttctttccactatagtactaggctgcctca
caggaaggtggcagaaacagatcccaggggcctctgattttgcttcccaccttcctgcag
GTGGAAGTCAAGATGGAGGGGGACTCTGTGCTGCTGGAGGTGGATGGGGAGGAGGTGCTG
CGCCTGAGACAGGTCTCTGGGCCCCTGACCAGCAAACGCCATCCCATCATGAGGATTGCG
CTTGGGGGGCTGCTCTTCCCCGCTTCCAACCTTCGGTTGCCG
gtaactacaccccaggggtggaaccctagccaagacttggtaaagcactgctgggtggct
ggccgtgggaatctaagtccacacttttagggagaagggaagggttgagagctgcaaggg
ggaggccaaatgctcagaggggagtcaactgagggcagggaggtcgggactgcggctccg

Exon  4 +       2617       2776   0   Internal    160    62    Marginal
ctgctgggtggctggccgtgggaatctaagtccacacttttagggagaagggaagggttg
agagctgcaagggggaggccaaatgctcagaggggagtcaactgagggcagggaggtcgg
gactgcggctccgatgccctgatttctacatccccgtatcttatctctgtcacactccag
CTGGTTCCTGCCCTGGATGGCTGCCTGCGCCGGGATTCCTGGCTGGACAAACAGGCCGAG
ATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTAGAATCAAATCCCGGGATA
TTTCTCCCTCCAGGGACTCAGGCAGAATTCAATCTCCGAG
gtagatttcctcggagtctatttttcccaccctggccagctcagcctgcctctgtccccc
tctaccactggcccctttcctccttgagaccccagctttgaggcctcaggataatcattt
ctccccacagacattccccagcctcatgcagagccctgggccttctctttggacctggga

Exon  5 +       3811       3987   1   Internal    177    80        Good
ttggggcaggatttaagtggtgagaatggccagtaggtggaggcatagcgaagaggcaga
attaaggcagctaggggtgaggccacaggcagtaggcccggctcattcttccctctctct
ctaccgtccctttcccacacactctgcagaaggtggtgttgtcttctgggtcggggccag
GGCTGGATCTGCCCCTGGTCTTGGGACTCCCTCTTCAGCTGAAGCTGAGTATGTCCAGGG
TGGTCTTGAGCCAAGGGTCGAAGATGAAGGCCCTTGCCCTGCCTCCCTTAGGCCTGGCTC
CCCTCCTTAACCTCTGGGCCAAGCCTCAAGGGCGTCTCTTCCTGGGGGCTTTACCAG
gtaagagagaatgatgttcaagttcatgagcacaacattggaaacagctcaagggaggcg
gcacattttgaggggaaggaaacctctgggagggaagaagaataggccacaagaagaaga
tatgggggcagtggaaggtagtgcttttgcaaactcaggttggaggagtggaaaagtggg

Exon  6 +       4232       4380   1   Terminal    149    51    Marginal
attttgaggggaaggaaacctctgggagggaagaagaataggccacaagaagaagatatg
ggggcagtggaaggtagtgcttttgcaaactcaggttggaggagtggaaaagtggggaga
agattctggatccgagccaccttaatgctctaatgccacctttgcactacctccctctag
GAGAAGACTCTTCCACCTCTTTTTGCCTGAATGGCCTTTGGGCACAAGGTCAGAGGCTGG
ATGTGGACCAGGCCCTGAACAGAAGCCATGAGATCTGGACTCACAGCTGCCCCCAGAGCC
CAGGCAATGGCACTGACGCTTCCCATTAA
agctccacctaagaaccccctttgaaagttactgattattcatttattcaacaaatattc
actgtgcactagcaatgtaccaggcactgtgccaagtattgagttgtcttaatgagcaaa
aacactctggttcctaccctcttggtgcccacagtcccatagggaagcagacatccatca

--------------------------------------------------------------------------------