--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28924 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      18399      18547   1   Internal    149   100   Excellent
tcattggcagcctcctgccctgagtctggctggggagtcccagttttcttaagacttgaa
tcctgccagcagtggtgaggctgggagaggctcttaggagggacggtgaggcagggtgga
gcttggtactaaggatggcgacctaggtctctaactgcccctcccctcttctctctctag
CCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCC
CTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACT
ATGGGGTCAGCGCCTGTGAGGGCTGCAAG
gtgagttgaaggggtcattgggaaggacagcttgatgaggtcaatgggatgtccccactt
ctgtgtcctgggagtgtgcagttggggggtgtccctgaagttgctgctcttctttctctg
tggaagttggcagcaagcagggacacctaccacagtttccccacaggtcctcccccataa

Exon  2 +      19867      20050   0   Internal    184   100   Excellent
tgaggaggatccttttaggtgaatcattctccccagcttttctggcctgctcaggtaggc
gatgggcaaacgcttgggggcagcagctggcctggccctcctcccctagactgagaccgt
agccaggcactgctcccactgtgggtgtggacaacctgactccctcccctccatacccag
GGCTTCTTCCGCCGCAGCATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAAC
TGCATCATCAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCTTT
GAAGTGGGCATGTCCAAGGAGTGTGAGTGCCATAGGGCAGGGGCCGAGTCCCGCCTCAGT
TGGG
gtctcagatgctcctaaagaccaagggagcagggctctgtggatgtttgtgcacatgcat
gaacacgcatgccgtggtgtgcgggctcacggttgaggatggtttgtgtgtagctgcaag
gacctgtttgcgagtctggctggctgtgtgtccacgggcaggtctgtgctccgggaccgt

Exon  3 +      21993      22153   1   Internal    161    99   Excellent
gtgggcatggagggctggagtgcgtggcaatgccttgcctgcccgtgaacgcgtgctgtg
tgcgcgtgcttacaagcctgggtgacctcctcagcagctggcagctctctgtcaggctgg
gggtggacgaggccctgagcagcctgcagctgccctcttaaccccctctgccctccacag
CTGTGAGAAACGACCGAAACAAGAAGAAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGA
GCTACACGCTGACGCCGGAGGTGGGGGAGCTCATTGAGAAGGTGCGCAAAGCGCACCAGG
AAACCTTCCCTGCCCTCTGCCAGCTGGGCAAATACACTACG
gtatggctttcccccggcctgcagggtgggatttgcccagggccacagggccaggatggg
cccctctcaggcaccccttcttgtgccaggcaagatctctgcgtccttcccttcccctct
cttctccctcctcctgctgcctcttcccaaggagctcccaggaagtgaaggctgggtaga

Exon  4 +      22414      22590   0   Internal    177   100   Excellent
ttgtgccaggcaagatctctgcgtccttcccttcccctctcttctccctcctcctgctgc
ctcttcccaaggagctcccaggaagtgaaggctgggtagagggcaggcctgtgggggctg
gagccaggctgagaaggggtgccatggagaagaaggccctcactctccctcctcccccag
AACAACAGCTCAGAACAACGTGTCTCTCTGGACATTGACCTCTGGGACAAGTTCAGTGAA
CTCTCCACCAAGTGCATCATTAAGACTGTGGAGTTCGCCAAGCAGCTGCCCGGCTTCACC
ACCCTCACCATCGCCGACCAGATCACCCTCCTCAAGGCTGCCTGCCTGGACATCCTG
gtgagggtctgcaccctggcccccaggcactgcccctgtgtcctgggtagatgtccttcc
agccagacagccaccctcctaaatgtctgtctgcaatcaacctgtccaaatgcccaccgc
ccaaatgtctgcccttcctctccccatatgtccacctgtccactcgtctccctgtccact

Exon  5 +      24385      24589   0   Internal    205    97   Excellent
gctgaggtatggatggtgcagacgtagaacctttccatcattgtagaaaattctatcaga
cagcattgctccggccacctgccaggtggtcctccgggagtgctggtgcggagtgctggt
gccgagtgctcagagtgggttcgggttcagtccctgaacccaagcatcctctgcacccag
ATCCTGCGGATCTGCACGCGGTACACGCCCGAGCAGGACACCATGACCTTCTCGGACGGG
CTGACCCTGAACCGGACCCAGATGCACAACGCTGGCTTCGGCCCCCTCACCGACCTGGTC
TTTGCCTTCGCCAACCAGCTGCTGCCCCTGGAGATGGATGATGCGGAGACGGGGCTGCTC
AGCGCCATCTGCCTCATCTGCGGAG
gtgggcagggggcctgggtctgggggctgggctgggacgggggtgcagccctggagtctc
ttccagggagctctttcaggccacctctgttaggtatctctagagggcagggtctggtct
gcaactacacagcaagggggccatgtggggcctggactcctgttcccgatttctgggcaa

Exon  6 +      25346      25504   1   Internal    159   100   Excellent
gttgctcccttttaagggcctctgtaccctgcggcagcagagaccccatgccctgccctg
tgtggggaggcgcctgcgagctgccctcctccatggcctgggcaggcacgccccccggtg
gccgaggctgggggtgcagctgtgttcccagctgctcagggggtggttctgcttcctcag
ACCGCCAGGACCTGGAGCAGCCGGACCGGGTGGACATGCTGCAGGAGCCGCTGCTGGAGG
CGCTAAAGGTCTACGTGCGGAAGCGGAGGCCCAGCCGCCCCCACATGTTCCCCAAGATGC
TAATGAAGATTACTGACCTGCGAAGCATCAGCGCCAAGG
gtgaggctcacagacctggaggggtaccggcccccgacacctggcccaggcccccacatc
caagccagcaccccatgtctttgtgccaggacaatacgacacctgtccccatctgtgtct
aggctgaggtcccctagtgactccactttgccgaggtggcccgcctgtgtcacctttgtg

Exon  7 +      26092      26205   1   Internal    114   100   Excellent
cattgccaccagcctctggacctgggggcttaagagagctggctcgtgtcaaagaactga
atcccaagaaagatgctaatatcagcagtattgatcttcccacctcgagccaggcttgct
ggggctgggggtgggagggctggcccagcgtgctgacctctgccccctcctttcctgcag
GGGCTGAGCGGGTGATCACGCTGAAGATGGAGATCCCGGGCTCCATGCCGCCTCTCATCC
AGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGG
gtggggggcgggacgggggtggcctggcccccccgccaggcagctgtagccccagcctca
gccccagctccaacagaagcagcccggccacccactccccgtgaccgcccacgccacatg
gacacagccctcgccctccgccccggcttttctctgcctttctaccgaccatgtgacccc

--------------------------------------------------------------------------------